Detailed information on ENST00000590197

lncRNA-RNA interactions

Number of interactions: 80

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000590197 620 300 UTR3 Trans
ENST00000361228 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 protein coding ENST00000590197 662 299 UTR3 Trans
ENST00000378004 Rho GTPase activating protein 26 protein coding ENST00000590197 602 293 UTR3 Trans
ENST00000423516 transketolase protein coding ENST00000590197 576 303 CDS Trans
ENST00000470361 potassium large conductance calcium-activated channel, subfamily M, beta member 2 processed transcript ENST00000590197 618 299 noncoding Trans
ENST00000472528 transketolase nonsense mediated decay ENST00000590197 576 303 UTR3 Trans
ENST00000475187 THO complex 5 retained intron ENST00000590197 650 302 noncoding Trans
ENST00000521027 pleckstrin and Sec7 domain containing 3 protein coding ENST00000590197 551 310 CDS_UTR Trans
ENST00000553936 gephyrin nonsense mediated decay ENST00000590197 644 310 CDS_UTR Trans
ENST00000569455 cadherin 13 processed transcript ENST00000590197 681 304 noncoding Trans
ENST00000620139 melanoregulin protein coding ENST00000590197 602 304 UTR3 Trans
TCONS_00001594 lincRNA novel protein coding ENST00000590197 629 295 UTR5 Trans
TCONS_00005323 polypyrimidine tract binding protein 2 novel protein coding ENST00000590197 658 307 UTR3 Trans
TCONS_00005324 polypyrimidine tract binding protein 2 novel protein coding ENST00000590197 658 307 UTR3 Trans
TCONS_00025805 zinc finger, MIZ-type containing 1 novel protein coding ENST00000590197 618 305 UTR3 Trans
TCONS_00033132 dynein heavy chain domain 1 novel protein coding ENST00000590197 659 301 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000590197 639 301 UTR5 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000590197 621 294 UTR5 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000590197 658 298 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000590197 639 285 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000590197 678 300 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000590197 678 300 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 606 303 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 666 298 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 606 303 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 666 298 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 606 303 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 572 297 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 666 298 UTR3 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 606 303 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 666 298 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 606 303 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 666 298 UTR3 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 606 303 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590197 666 298 UTR3 Trans
TCONS_00114623 glutamine rich 2 novel protein coding ENST00000590197 618 304 UTR5 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding ENST00000590197 660 302 UTR3 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding ENST00000590197 618 304 UTR5 Trans
TCONS_00116334 low density lipoprotein receptor class A domain containing 4 novel protein coding ENST00000590197 686 300 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000590197 640 300 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000590197 653 301 UTR5 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000590197 601 308 UTR3 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000590197 676 300 UTR5 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000590197 641 291 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000590197 641 291 UTR3 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000590197 641 291 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000590197 641 291 UTR3 Trans
TCONS_00141681 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000590197 641 291 UTR3 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding ENST00000590197 610 290 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000590197 620 300 UTR3 Trans
TCONS_00159951 zinc fingers and homeoboxes 3 novel protein coding ENST00000590197 624 301 UTR5 Trans
TCONS_00163348 runt-related transcription factor 1 novel protein coding ENST00000590197 613 298 UTR3 Trans
TCONS_00163350 runt-related transcription factor 1 novel protein coding ENST00000590197 613 298 UTR3 Trans
TCONS_00163352 runt-related transcription factor 1 novel protein coding ENST00000590197 613 298 UTR3 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000590197 641 304 UTR5 Trans
TCONS_00173724 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000590197 608 301 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000590197 608 301 UTR5 Trans
TCONS_00173730 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000590197 608 301 UTR5 Trans
TCONS_00175515 transient receptor potential cation channel, subfamily C, member 1 novel protein coding ENST00000590197 639 301 UTR5 Trans
TCONS_00180672 transketolase novel protein coding ENST00000590197 576 303 UTR5 Trans
TCONS_00180673 transketolase novel protein coding ENST00000590197 576 303 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000590197 673 301 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000590197 625 304 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000590197 616 279 UTR5 Trans
TCONS_00196430 trio Rho guanine nucleotide exchange factor novel protein coding ENST00000590197 622 300 UTR3 Trans
TCONS_00196432 trio Rho guanine nucleotide exchange factor novel protein coding ENST00000590197 622 300 UTR3 Trans
TCONS_00199451 solute carrier family 12 (sodium/potassium/chloride transporter), member 2 novel protein coding ENST00000590197 616 298 UTR3 Trans
TCONS_00203197 3-oxoacid CoA transferase 1 novel protein coding ENST00000590197 633 303 UTR3 Trans
TCONS_00203198 3-oxoacid CoA transferase 1 novel protein coding ENST00000590197 633 303 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000590197 602 308 UTR3 Trans
TCONS_00204896 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000590197 618 312 UTR5 Trans
TCONS_00212185 TEC novel protein coding ENST00000590197 592 298 UTR3 Trans
TCONS_00213775 LYR motif containing 4 novel noncoding ENST00000590197 623 293 noncoding Trans
TCONS_00235708 oxidation resistance 1 novel protein coding ENST00000590197 655 298 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000590197 623 296 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000590197 640 298 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000590197 652 305 UTR3 Trans
TCONS_00247562 contactin associated protein-like 3 novel protein coding ENST00000590197 628 298 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000590197 612 298 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000590197 623 300 UTR5 Trans

Sequence

>TCONS_00252827 (1761 nt)
TTTTTTTTTTTTTTTTTTTTAAGCAAGCCCCCAACACCATAGAAAATTCTTGATTTGCTCGGAGGATAATTGGATGAAGGATTATTTTCTTCTTTGTTTA
TGTGCAAGAAATGAAAATAAGGAATTGCTTTGATCAGACAACTTCTTATCTTTGTGGTAGAAACAGAACTGCCCTTCTTGGAGTGGCTCTGCCTCTGAGA
TCACTACAGGGGAGACAGCATGCCCTGTTCAGCTGGCTGAATATTTGGCAACAATCTCCTGAAGCAGCTGGAATTGACAAGAAGTACTGGAGATTAGCTC
GGGCCAAACCCTTACATCTGGCCTGACTACTGCTGCAGTCTGCCTCAACTTACCCCTAAAGCTGGGGAGATGCCACCCACCCACATCTTTGCTACACATG
CCATCATGAGCTAGAGTTCACCCTTTCTCCTTAAAGCCCTATTTACTTTTCTACTTCAACTTTAAAACAAAATTAAAATGTGAGGATATCCCTGAATTTT
AAAAAGCATGAAGTAAAAATGCAAATTAGTATAGTTTGTTTAATACATTACATATAGACCTAAAGAAAGTTCATCAGGGTTAATCATTTGTCACATCATT
CTATACCCAGGGCTATCAGCTATCAATTTTCCTTTTTTTTTTTTTTTTAATTCAGGATCCAGCTCTGTCACCCAGGCTGGAGTGCAGTATCAAAGTATCA
TTTCTCTTACTTCAAATTATTACATTTTATTCTGTACATTGATTCTGAACTCCTAATATAATATTTATGTCCTGTATTTGCAGGCCATTGGTTTTTTTAA
AGTCATAAATCAAAATGATGCCAGAAAATCAAAGATGCCCAAGATGTTGGGCTTCTCTTTTGCCAGCCACATTGGTAGCACTCTCCTGCCCTGGCCTCCA
AGCTGGTGGGGATCTGTGATGTTTGTGAAAATGGGCTTATGCCAGGCGCAGTGGCTCACGCCTATAATCCCAGCACTTTGGGAGGCCGAGGCGGGCAGAT
CGGTTCAGGTCAGGAGATCGAGACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAATTAGCCAGGTGTGGTGGCACATGCCTG
TAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCACTTGAAACCTGGGAGGCGGAGGTTGCAGTGAGCAGAGATCGTGCCATTACACTCCAGCCTGG
GCTACAGAGTGAGACTCTGTGTCAAAAAAAAAAAAGAAAGAAAATGGGCTTGTGTGGTAGCAGGTAAGAAATTGAATCTCTGTTGTACAGCAGCTAGCTG
TACTGCATGATCACTTCCCATTCCCCAGCTGACAGTGGCTGTCTCTGGAACTCCTACCACAGTCTTCAATTGGTAGGCCAGCCCTGGTGCCAGTGATTTT
ATCTGGGCATGGAAAATGCCACTTGCTTCTGTGGAAGAGACACTTAAAAGATCTGGCAGTCGGCCGGGTGCGGTGGCTCACGCCTATAATCCCAACACTC
TGGGAGGTCAAGGCAGGCGGATCACGAGGTCAGGAGATGGAGACCATCCTGGCTAACACGGTGAAACCCTGTCTCTACTAAAAAAAAAAATAAAAAATTA
GCTGGGCGAGGTGGCGGGCGCCTGTAGTCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATGGCGTGAACCCAGGAGGCGGAGCTTGCAGTGATCCGAGAT
CACACCACTGCACTGCAGTCTGGGCAACAGAGCGAGACTCCATCTCAAAAAAAAAAAAAAAA

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.