Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
---|---|---|---|---|---|---|---|---|
ENST00000257287 | centrosomal protein 135kDa | protein coding | ENST00000590241 | 621 | 297 | UTR3 | Trans | |
ENST00000304748 | formyl peptide receptor 1 | protein coding | ENST00000590241 | 559 | 284 | UTR3 | Trans | |
ENST00000338758 | parvin, beta | protein coding | ENST00000590241 | 618 | 303 | UTR3 | Trans | |
ENST00000339732 | polypeptide N-acetylgalactosaminyltransferase 15 | protein coding | ENST00000590241 | 606 | 297 | UTR3 | Trans | |
ENST00000378004 | Rho GTPase activating protein 26 | protein coding | ENST00000590241 | 552 | 302 | UTR3 | Trans | |
ENST00000389534 | zinc finger protein 841 | protein coding | ENST00000590241 | 617 | 268 | UTR3 | Trans | |
ENST00000391877 | delta(4)-desaturase, sphingolipid 1 | protein coding | ENST00000590241 | 502 | 284 | UTR3 | Trans | |
ENST00000424496 | sense_intronic | sense intronic | ENST00000590241 | 552 | 298 | noncoding | Trans | |
ENST00000426391 | zinc finger protein 841 | protein coding | ENST00000590241 | 617 | 268 | UTR3 | Trans | |
ENST00000448214 | antisense | antisense | ENST00000590241 | 506 | 294 | noncoding | Trans | |
ENST00000482603 | glyoxylate reductase/hydroxypyruvate reductase | processed transcript | ENST00000590241 | 587 | 282 | noncoding | Trans | |
ENST00000498813 | delta(4)-desaturase, sphingolipid 1 | processed transcript | ENST00000590241 | 593 | 307 | noncoding | Trans | |
ENST00000506202 | centrosomal protein 135kDa | retained intron | ENST00000590241 | 621 | 297 | noncoding | Trans | |
ENST00000560870 | sense_intronic | sense intronic | ENST00000590241 | 522 | 257 | noncoding | Trans | |
ENST00000594295 | zinc finger protein 841 | protein coding | ENST00000590241 | 617 | 268 | UTR3 | Trans | |
TCONS_00001821 | low density lipoprotein receptor adaptor protein 1 | novel protein coding | ENST00000590241 | 619 | 281 | UTR5 | Trans | |
TCONS_00001823 | low density lipoprotein receptor adaptor protein 1 | novel protein coding | ENST00000590241 | 619 | 281 | UTR5 | Trans | |
TCONS_00009834 | SRY (sex determining region Y)-box 13 | novel protein coding | ENST00000590241 | 674 | 293 | UTR3 | Trans | |
TCONS_00028040 | ankyrin repeat domain 16 | novel protein coding | ENST00000590241 | 631 | 283 | UTR3 | Trans | |
TCONS_00030165 | antisense | novel protein coding | ENST00000590241 | 506 | 294 | UTR5 | Trans | |
TCONS_00030591 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000590241 | 610 | 297 | UTR3 | Trans | |
TCONS_00030592 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000590241 | 610 | 297 | UTR3 | Trans | |
TCONS_00051246 | sterol O-acyltransferase 2 | novel protein coding | ENST00000590241 | 618 | 291 | UTR5 | Trans | |
TCONS_00076763 | protein phosphatase 1, regulatory subunit 13B | novel protein coding | ENST00000590241 | 612 | 298 | UTR3 | Trans | |
TCONS_00098643 | fatty acid 2-hydroxylase | novel protein coding | ENST00000590241 | 629 | 281 | UTR5 | Trans | |
TCONS_00098644 | fatty acid 2-hydroxylase | novel protein coding | ENST00000590241 | 629 | 281 | UTR3 | Trans | |
TCONS_00098645 | fatty acid 2-hydroxylase | novel protein coding | ENST00000590241 | 629 | 281 | UTR3 | Trans | |
TCONS_00098647 | fatty acid 2-hydroxylase | novel protein coding | ENST00000590241 | 629 | 281 | UTR3 | Trans | |
TCONS_00103554 | tubulin, gamma 2 | novel protein coding | ENST00000590241 | 605 | 291 | UTR5 | Trans | |
TCONS_00124891 | zinc finger protein 540 | novel protein coding | ENST00000590241 | 608 | 301 | UTR5 | Trans | |
TCONS_00135631 | zinc finger protein 841 | novel protein coding | ENST00000590241 | 617 | 268 | UTR3 | Trans | |
TCONS_00135644 | zinc finger protein 841 | novel protein coding | ENST00000590241 | 617 | 268 | UTR3 | Trans | |
TCONS_00149280 | Uncharacterized protein {ECO:0000313|Ensembl:ENSP00000416453} | novel protein coding | ENST00000590241 | 607 | 296 | UTR3 | Trans | |
TCONS_00150696 | septin 10 | novel protein coding | ENST00000590241 | 602 | 291 | UTR3 | Trans | |
TCONS_00161482 | BTB and CNC homology 1, basic leucine zipper transcription factor 1 | novel protein coding | ENST00000590241 | 601 | 299 | UTR3 | Trans | |
TCONS_00194652 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000590241 | 601 | 299 | UTR5 | Trans | |
TCONS_00194655 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000590241 | 601 | 299 | UTR5 | Trans | |
TCONS_00202516 | family with sequence similarity 173, member B | novel protein coding | ENST00000590241 | 607 | 302 | UTR3 | Trans | |
TCONS_00203985 | family with sequence similarity 169, member A | novel protein coding | ENST00000590241 | 611 | 297 | UTR5 | Trans | |
TCONS_00213738 | enoyl-CoA delta isomerase 2 | novel protein coding | ENST00000590241 | 562 | 300 | UTR3 | Trans | |
TCONS_00232466 | tumor suppressor candidate 3 | novel protein coding | ENST00000590241 | 513 | 279 | UTR3 | Trans | |
TCONS_00232467 | tumor suppressor candidate 3 | novel protein coding | ENST00000590241 | 513 | 279 | UTR3 | Trans | |
TCONS_00233718 | pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 | novel protein coding | ENST00000590241 | 618 | 291 | UTR5 | Trans | |
TCONS_00247058 | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 | novel protein coding | ENST00000590241 | 608 | 284 | UTR3 | Trans | |
TCONS_00251977 | G protein-coupled receptor 82 | novel protein coding | ENST00000590241 | 557 | 290 | UTR3 | Trans | |
TCONS_00252827 | discs, large homolog 3 (Drosophila) | novel protein coding | ENST00000590241 | 623 | 303 | UTR5 | Trans |
>TCONS_00252827 (569 nt)
GTTTGTTTTTTTTTCTTTTTTTTGAGATGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCATGATCTTGGCTCACTGCAACCTCCACCTCCTGA
GTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGTAGGGACTACCAGCTTACACTACCACGCCCAGCTGATGTTTGTATTTTTAGTAGAGACGGGGTT
TCATCATATTGGCCAGGCTGGTCTTGAACTCCTGACCTCAAGTGATCCACCCGCCTCGGCCTCCCAAAGTGGTGGGATTACAGGCATGAGCCACCGCACC
CGCCTAAGAAGGTGCTTTTGAGGTGACAACAGTGTTCTAAATCTTAACTGGGATTGTGGTTACATGGGTCTATACACTTATTGGACTACTGAACCATACA
TTGTAAATGGTTATACTGTATTGTATGTAAGTTACACGAGAATAAAGATGATTTAGAGAGTTAGAAACAAAACAAGAATGAAGAATGATGCTTGTTTTGC
TCACCATCTAGCAGAAAAGCCAGACATACAAATAATCATCAAACAGTGGGATGAGTGTTCAAAGTATGTT
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.