Detailed information on ENST00000590241

lncRNA-RNA interactions

Number of interactions: 46

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000257287 centrosomal protein 135kDa protein coding ENST00000590241 621 297 UTR3 Trans
ENST00000304748 formyl peptide receptor 1 protein coding ENST00000590241 559 284 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000590241 618 303 UTR3 Trans
ENST00000339732 polypeptide N-acetylgalactosaminyltransferase 15 protein coding ENST00000590241 606 297 UTR3 Trans
ENST00000378004 Rho GTPase activating protein 26 protein coding ENST00000590241 552 302 UTR3 Trans
ENST00000389534 zinc finger protein 841 protein coding ENST00000590241 617 268 UTR3 Trans
ENST00000391877 delta(4)-desaturase, sphingolipid 1 protein coding ENST00000590241 502 284 UTR3 Trans
ENST00000424496 sense_intronic sense intronic ENST00000590241 552 298 noncoding Trans
ENST00000426391 zinc finger protein 841 protein coding ENST00000590241 617 268 UTR3 Trans
ENST00000448214 antisense antisense ENST00000590241 506 294 noncoding Trans
ENST00000482603 glyoxylate reductase/hydroxypyruvate reductase processed transcript ENST00000590241 587 282 noncoding Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000590241 593 307 noncoding Trans
ENST00000506202 centrosomal protein 135kDa retained intron ENST00000590241 621 297 noncoding Trans
ENST00000560870 sense_intronic sense intronic ENST00000590241 522 257 noncoding Trans
ENST00000594295 zinc finger protein 841 protein coding ENST00000590241 617 268 UTR3 Trans
TCONS_00001821 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000590241 619 281 UTR5 Trans
TCONS_00001823 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000590241 619 281 UTR5 Trans
TCONS_00009834 SRY (sex determining region Y)-box 13 novel protein coding ENST00000590241 674 293 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000590241 631 283 UTR3 Trans
TCONS_00030165 antisense novel protein coding ENST00000590241 506 294 UTR5 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000590241 610 297 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000590241 610 297 UTR3 Trans
TCONS_00051246 sterol O-acyltransferase 2 novel protein coding ENST00000590241 618 291 UTR5 Trans
TCONS_00076763 protein phosphatase 1, regulatory subunit 13B novel protein coding ENST00000590241 612 298 UTR3 Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000590241 629 281 UTR5 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000590241 629 281 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000590241 629 281 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000590241 629 281 UTR3 Trans
TCONS_00103554 tubulin, gamma 2 novel protein coding ENST00000590241 605 291 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000590241 608 301 UTR5 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000590241 617 268 UTR3 Trans
TCONS_00135644 zinc finger protein 841 novel protein coding ENST00000590241 617 268 UTR3 Trans
TCONS_00149280 Uncharacterized protein {ECO:0000313|Ensembl:ENSP00000416453} novel protein coding ENST00000590241 607 296 UTR3 Trans
TCONS_00150696 septin 10 novel protein coding ENST00000590241 602 291 UTR3 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000590241 601 299 UTR3 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000590241 601 299 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000590241 601 299 UTR5 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000590241 607 302 UTR3 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000590241 611 297 UTR5 Trans
TCONS_00213738 enoyl-CoA delta isomerase 2 novel protein coding ENST00000590241 562 300 UTR3 Trans
TCONS_00232466 tumor suppressor candidate 3 novel protein coding ENST00000590241 513 279 UTR3 Trans
TCONS_00232467 tumor suppressor candidate 3 novel protein coding ENST00000590241 513 279 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000590241 618 291 UTR5 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000590241 608 284 UTR3 Trans
TCONS_00251977 G protein-coupled receptor 82 novel protein coding ENST00000590241 557 290 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000590241 623 303 UTR5 Trans

Sequence

>TCONS_00252827 (569 nt)
GTTTGTTTTTTTTTCTTTTTTTTGAGATGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCATGATCTTGGCTCACTGCAACCTCCACCTCCTGA
GTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGTAGGGACTACCAGCTTACACTACCACGCCCAGCTGATGTTTGTATTTTTAGTAGAGACGGGGTT
TCATCATATTGGCCAGGCTGGTCTTGAACTCCTGACCTCAAGTGATCCACCCGCCTCGGCCTCCCAAAGTGGTGGGATTACAGGCATGAGCCACCGCACC
CGCCTAAGAAGGTGCTTTTGAGGTGACAACAGTGTTCTAAATCTTAACTGGGATTGTGGTTACATGGGTCTATACACTTATTGGACTACTGAACCATACA
TTGTAAATGGTTATACTGTATTGTATGTAAGTTACACGAGAATAAAGATGATTTAGAGAGTTAGAAACAAAACAAGAATGAAGAATGATGCTTGTTTTGC
TCACCATCTAGCAGAAAAGCCAGACATACAAATAATCATCAAACAGTGGGATGAGTGTTCAAAGTATGTT

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.