Detailed information on ENST00000590689

lncRNA-RNA interactions

Number of interactions: 153

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000264914 arylsulfatase B protein coding ENST00000590689 604 301 UTR3 Trans
ENST00000295822 eukaryotic translation initiation factor 5A2 protein coding ENST00000590689 604 299 UTR3 Trans
ENST00000301178 AXL receptor tyrosine kinase protein coding ENST00000590689 649 298 UTR3 Trans
ENST00000357613 transmembrane protein 170A protein coding ENST00000590689 614 285 UTR3 Trans
ENST00000375120 OTU deubiquitinase 3 protein coding ENST00000590689 704 302 UTR3 Trans
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000590689 582 299 UTR3 Trans
ENST00000378004 Rho GTPase activating protein 26 protein coding ENST00000590689 613 281 UTR3 Trans
ENST00000395811 myosin phosphatase Rho interacting protein protein coding ENST00000590689 618 303 UTR3 Trans
ENST00000396349 MANSC domain containing 1 protein coding ENST00000590689 577 302 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000590689 574 287 noncoding Trans
ENST00000403729 anthrax toxin receptor 2 protein coding ENST00000590689 523 299 UTR3 Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000590689 582 299 UTR3 Trans
ENST00000473091 UBA domain containing 2 processed transcript ENST00000590689 615 311 noncoding Trans
ENST00000475187 THO complex 5 retained intron ENST00000590689 552 303 noncoding Trans
ENST00000491277 protein tyrosine phosphatase, non-receptor type 14 processed transcript ENST00000590689 626 294 noncoding Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000590689 634 299 CDS Trans
ENST00000507518 hydroxysteroid (17-beta) dehydrogenase 11 processed transcript ENST00000590689 504 222 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000590689 594 305 CDS_UTR Trans
ENST00000517408 antisense antisense ENST00000590689 581 302 noncoding Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000590689 616 288 CDS_UTR Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay ENST00000590689 614 285 UTR3 Trans
ENST00000569540 transmembrane protein 170A protein coding ENST00000590689 614 285 UTR3 Trans
ENST00000588483 tropomyosin 4 protein coding ENST00000590689 550 298 UTR5 Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000590689 628 291 UTR3 Trans
ENST00000614987 ribosomal protein S6 kinase, 90kDa, polypeptide 5 protein coding ENST00000590689 609 293 UTR3 Trans
TCONS_00014134 collagen, type XVI, alpha 1 novel protein coding ENST00000590689 646 306 UTR3 Trans
TCONS_00023291 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000590689 501 259 UTR3 Trans
TCONS_00023292 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000590689 501 259 UTR3 Trans
TCONS_00023296 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000590689 501 259 UTR3 Trans
TCONS_00023298 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000590689 501 259 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000590689 667 303 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000590689 631 286 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000590689 644 298 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000590689 604 268 UTR3 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000590689 661 303 UTR3 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000590689 661 303 UTR3 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000590689 644 305 UTR5 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000590689 617 288 UTR3 Trans
TCONS_00061168 UHRF1 binding protein 1-like novel protein coding ENST00000590689 504 302 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000590689 662 298 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000590689 662 298 UTR5 Trans
TCONS_00065864 long intergenic non-protein coding RNA 412 novel protein coding ENST00000590689 629 305 UTR3 Trans
TCONS_00069481 pellino E3 ubiquitin protein ligase family member 2 novel protein coding ENST00000590689 602 289 UTR5 Trans
TCONS_00069482 pellino E3 ubiquitin protein ligase family member 2 novel protein coding ENST00000590689 602 289 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000590689 617 282 UTR5 Trans
TCONS_00074894 lincRNA novel protein coding ENST00000590689 628 287 UTR3 Trans
TCONS_00074894 lincRNA novel protein coding ENST00000590689 622 305 UTR3 Trans
TCONS_00075834 forkhead box N3 novel protein coding ENST00000590689 601 290 UTR3 Trans
TCONS_00075835 forkhead box N3 novel protein coding ENST00000590689 601 290 UTR3 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000590689 623 303 UTR5 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000590689 614 283 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000590689 614 283 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000590689 614 283 UTR3 Trans
TCONS_00098745 transmembrane protein 170A novel protein coding ENST00000590689 619 295 UTR3 Trans
TCONS_00098745 transmembrane protein 170A novel protein coding ENST00000590689 614 285 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000590689 681 303 UTR5 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000590689 629 312 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000590689 681 303 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000590689 629 312 UTR5 Trans
TCONS_00104867 hepatic leukemia factor novel protein coding ENST00000590689 651 300 UTR3 Trans
TCONS_00104871 hepatic leukemia factor novel protein coding ENST00000590689 651 300 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000590689 657 311 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000590689 690 277 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000590689 690 277 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000590689 568 288 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590689 623 296 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590689 623 296 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590689 623 296 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590689 623 296 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590689 623 296 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590689 623 296 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000590689 623 296 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000590689 634 298 UTR3 Trans
TCONS_00116327 low density lipoprotein receptor class A domain containing 4 novel protein coding ENST00000590689 617 284 UTR3 Trans
TCONS_00118358 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000590689 600 283 UTR5 Trans
TCONS_00118361 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000590689 628 302 UTR5 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000590689 646 300 UTR3 Trans
TCONS_00123889 ribosomal protein SA pseudogene 58 novel protein coding ENST00000590689 660 289 UTR5 Trans
TCONS_00123899 ribosomal protein SA pseudogene 58 novel protein coding ENST00000590689 660 289 UTR5 Trans
TCONS_00125532 AXL receptor tyrosine kinase novel protein coding ENST00000590689 649 298 UTR3 Trans
TCONS_00141404 GLI family zinc finger 2 novel protein coding ENST00000590689 679 277 UTR5 Trans
TCONS_00142174 LY6/PLAUR domain containing 6B novel protein coding ENST00000590689 636 287 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000590689 612 292 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000590689 609 290 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000590689 615 282 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000590689 612 292 UTR5 Trans
TCONS_00148698 WD repeat containing planar cell polarity effector novel noncoding ENST00000590689 626 278 noncoding Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000590689 626 278 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000590689 626 278 UTR3 Trans
TCONS_00150689 ectodysplasin A receptor novel protein coding ENST00000590689 608 300 UTR3 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000590689 615 299 UTR5 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000590689 638 274 UTR5 Trans
TCONS_00159951 zinc fingers and homeoboxes 3 novel protein coding ENST00000590689 602 317 UTR5 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000590689 605 296 UTR3 Trans
TCONS_00163084 T-cell lymphoma invasion and metastasis 1 novel protein coding ENST00000590689 639 298 UTR5 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000590689 631 285 noncoding Trans
TCONS_00173724 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000590689 650 286 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000590689 680 294 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000590689 650 286 UTR5 Trans
TCONS_00173891 RNA, U6 small nuclear 461, pseudogene novel protein coding ENST00000590689 579 288 UTR3 Trans
TCONS_00180671 transketolase novel protein coding ENST00000590689 613 283 UTR5 Trans
TCONS_00180672 transketolase novel protein coding ENST00000590689 613 283 UTR5 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000590689 578 298 UTR3 Trans
TCONS_00184374 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000590689 578 298 UTR3 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000590689 613 288 UTR5 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000590689 609 293 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000590689 638 304 UTR3 Trans
TCONS_00187473 spermatogenesis associated 18 novel noncoding ENST00000590689 601 300 noncoding Trans
TCONS_00189916 doublecortin-like kinase 2 novel protein coding ENST00000590689 600 300 UTR3 Trans
TCONS_00189917 doublecortin-like kinase 2 novel protein coding ENST00000590689 600 300 UTR3 Trans
TCONS_00189925 doublecortin-like kinase 2 novel protein coding ENST00000590689 600 300 UTR3 Trans
TCONS_00192322 tec protein tyrosine kinase novel protein coding ENST00000590689 607 304 UTR5 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000590689 618 303 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000590689 618 303 UTR5 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000590689 616 289 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000590689 631 283 UTR3 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000590689 634 287 UTR5 Trans
TCONS_00199451 solute carrier family 12 (sodium/potassium/chloride transporter), member 2 novel protein coding ENST00000590689 600 289 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000590689 660 287 UTR5 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000590689 637 307 UTR3 Trans
TCONS_00203947 ectodermal-neural cortex 1 (with BTB domain) novel protein coding ENST00000590689 585 297 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000590689 630 307 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000590689 630 307 UTR5 Trans
TCONS_00205414 prolyl 4-hydroxylase, alpha polypeptide II novel protein coding ENST00000590689 646 296 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000590689 622 277 UTR5 Trans
TCONS_00213775 LYR motif containing 4 novel noncoding ENST00000590689 685 303 noncoding Trans
TCONS_00219475 WD repeat domain 27 novel protein coding ENST00000590689 612 300 UTR3 Trans
TCONS_00221037 POU class 6 homeobox 2 novel noncoding ENST00000590689 636 299 noncoding Trans
TCONS_00224726 caldesmon 1 novel protein coding ENST00000590689 596 295 UTR3 Trans
TCONS_00224728 caldesmon 1 novel protein coding ENST00000590689 596 295 UTR3 Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000590689 661 295 UTR3 Trans
TCONS_00233179 BCL2/adenovirus E1B 19kDa interacting protein 3-like novel protein coding ENST00000590689 645 303 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000590689 614 297 UTR5 Trans
TCONS_00234826 zinc finger, C2HC-type containing 1A novel protein coding ENST00000590689 626 302 UTR3 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000590689 650 289 UTR3 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000590689 626 303 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000590689 626 303 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000590689 626 303 UTR3 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000590689 654 304 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000590689 671 296 UTR3 Trans
TCONS_00240045 zinc finger protein 706 novel protein coding ENST00000590689 575 299 UTR3 Trans
TCONS_00240046 zinc finger protein 706 novel protein coding ENST00000590689 575 299 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000590689 673 300 CDS_UTR Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000590689 643 305 UTR3 Trans
TCONS_00242866 glyoxylate reductase/hydroxypyruvate reductase novel protein coding ENST00000590689 629 302 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000590689 618 298 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000590689 618 298 UTR5 Trans
TCONS_00244033 WNK lysine deficient protein kinase 2 novel protein coding ENST00000590689 648 280 UTR5 Trans
TCONS_00244038 WNK lysine deficient protein kinase 2 novel protein coding ENST00000590689 648 280 UTR5 Trans
TCONS_00244055 WNK lysine deficient protein kinase 2 novel protein coding ENST00000590689 648 280 UTR3 Trans
TCONS_00244067 WNK lysine deficient protein kinase 2 novel protein coding ENST00000590689 648 280 UTR5 Trans
TCONS_00245543 long intergenic non-protein coding RNA 963 novel protein coding ENST00000590689 639 291 UTR3 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000590689 630 302 UTR3 Trans

Sequence

>TCONS_00247058 (833 nt)
GGCAGCCCGAGGGCGGCGCAAGGCCTGAGGCCCAGCACAGTGATGTCCGAGCTCAGCGATGAAGCCAGCGAGCCGGAACTCCTGAACCGCAGCTTGTCCA
TGTGGCACGGGCTCGGGACACAGGTCAGCGGGGAGGAGCTGGATGTCCCCCTGGATCTTCACACAGCTGCTTCCATTGGCCAGTATGAAGTGGTGAAGGA
GTGTGTGCAGCGGTAAGAGATCTCGGGGAACTTCCTCTCACATTTTGAGCAGCGCAGTGATGGCTTCGATCCCACGTGATGGGGCTTTGCACACAGTTGT
GGATGTTTAATGCGTGTAGAATAGGTTAACCTGCTTATCTCAGGCAGCTGTCAGTAAGTATTGATGCTGAGCCCTGACAAAGAGGCCGTTTTTATTCCTA
GGAAGAAAAAGAGGGAGTAAACTTTGATCAGAAGCTTATAAACAGTCATTCTTTAACCAGACTAATTTTATTCACTAATTGCAGAAATGCCCAAACAAAC
AAGCAAAATAAAAATAAAGACAGAAAGTGATGGCCTGGTGCGGTGGCTCACACTTGTAATTCCAGCACTTTGGGAGGCTGAGATGGGCGGGTCACTTGAG
GTCAGGAGTTTGAGACCATTCTGGATAACATGATGAAACCCCATCTCTACTAAAAATATAAAAGTTAGCTGGGTGTGGTGGCATGTACCTGTAATCCCAG
CTACTCAGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTACAGTGAGCTGAGATTGCGCCACTGCACTCTAGCCTGGGCAACAGAGT
GAGACTCTGTCTCAAAAACAAAAAAAAGAAAAAA

Expression



Full and truncated open reading frames discovered in TCONS_00247058

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.