Detailed information on ENST00000591251

lncRNA-RNA interactions

Number of interactions: 39

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263026 eukaryotic elongation factor-2 kinase protein coding ENST00000591251 622 312 UTR3 Trans
ENST00000264914 arylsulfatase B protein coding ENST00000591251 561 302 UTR3 Trans
ENST00000448612 WD repeat domain 27 protein coding ENST00000591251 522 314 CDS Trans
TCONS_00014134 collagen, type XVI, alpha 1 novel protein coding ENST00000591251 621 303 UTR3 Trans
TCONS_00032161 transcription elongation regulator 1-like novel protein coding ENST00000591251 552 323 UTR3 Trans
TCONS_00075339 latent transforming growth factor beta binding protein 2 novel protein coding ENST00000591251 577 307 UTR3 Trans
TCONS_00089062 eukaryotic elongation factor-2 kinase novel protein coding ENST00000591251 622 312 UTR3 Trans
TCONS_00089065 eukaryotic elongation factor-2 kinase novel protein coding ENST00000591251 622 312 UTR3 Trans
TCONS_00089066 eukaryotic elongation factor-2 kinase novel protein coding ENST00000591251 622 312 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000591251 635 307 UTR5 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000591251 611 325 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000591251 635 307 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000591251 611 325 UTR5 Trans
TCONS_00104871 hepatic leukemia factor novel protein coding ENST00000591251 513 305 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000591251 608 313 UTR5 Trans
TCONS_00118345 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000591251 534 322 UTR3 Trans
TCONS_00119478 zinc finger and BTB domain containing 7C novel protein coding ENST00000591251 603 304 UTR5 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000591251 608 300 noncoding Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000591251 591 312 UTR5 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000591251 630 303 UTR3 Trans
TCONS_00161498 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000591251 512 276 UTR3 Trans
TCONS_00166381 GRB2-related adaptor protein 2 novel protein coding ENST00000591251 604 325 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000591251 606 266 noncoding Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000591251 603 297 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000591251 627 310 UTR3 Trans
TCONS_00204896 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000591251 610 302 UTR5 Trans
TCONS_00205414 prolyl 4-hydroxylase, alpha polypeptide II novel protein coding ENST00000591251 611 315 UTR3 Trans
TCONS_00216524 collagen, type XXI, alpha 1 novel protein coding ENST00000591251 501 306 UTR3 Trans
TCONS_00219475 WD repeat domain 27 novel protein coding ENST00000591251 522 314 UTR3 Trans
TCONS_00233179 BCL2/adenovirus E1B 19kDa interacting protein 3-like novel protein coding ENST00000591251 606 301 UTR3 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000591251 601 312 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000591251 601 312 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000591251 601 312 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000591251 651 301 CDS_UTR Trans
TCONS_00242866 glyoxylate reductase/hydroxypyruvate reductase novel protein coding ENST00000591251 605 302 UTR3 Trans
TCONS_00251307 steroid sulfatase (microsomal), isozyme S novel protein coding ENST00000591251 571 308 UTR3 Trans
TCONS_00251309 steroid sulfatase (microsomal), isozyme S novel protein coding ENST00000591251 571 308 UTR3 Trans
TCONS_00253055 uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) novel protein coding ENST00000591251 577 309 UTR3 Trans
TCONS_00253258 sushi-repeat containing protein, X-linked 2 novel protein coding ENST00000591251 588 315 UTR3 Trans

Sequence

>TCONS_00253258 (972 nt)
ACGCGGGAGGAGGTTGTGGGGATATGGACGAGCATCCGAGGCCCCCGGTTACAGACGTTCCACGTTCCGTCTCCCTGTGCCAGCCCTCAGGACCTGAGCA
GCGGCCTTGCCGTAGCCTATGTGCTGAACCAGATGTGAGTGGAGCTGAAGGGGAGGATCCCAAAAGTGTCCCCCAGTCTGCTCATCCCACCTTCTCGCCC
CCAGAGACCCCTCCTGGTTCAACGAGGCATGGCTCCAGGGCATCTCGGAAGATCCAGGTCCCAACTGGAAGCTGAAGGTGACAAGTGGACTCCTGATTAG
AGGACAGACTGGTGAAGAGATGACCAGGGACGGGCCAGCTAGGCACATGTCCTGGGTGATGGGCAGGAAGAGGGACAGATGTCTGGTGATCAACCATTTG
TTCATCCATTCATCTATGGAGTACTCACCCTGTGCCAGGCCTGGGCATTCAGCAAGGAATAACACAGACAAAAACCTGCCCCACACAGCCATCATTCTAG
TGACAAGCAACACATACACAACCATAAAAATTAACTTCCAGGCTGGGCGCAGTGGCTCATGCCTGTAATCCCAACACTTTGAGAGGCTAAAGTGGGTGGA
TCACCTGGGGCCAGGAGTTCAAGACCAGCCTGGCCAACAAGTTGAAACCCCATCTCTACTAAAAATACAAAAATTAGCTGGGTGGGGTGGTGTGCACCTG
TAATCCCAGTTACTTGGGAGGCTGAGACATGAGAATCACTTGAACCTGGGAGGTGGAGGATGCAGTGAGCTGAGATTGAGCCATTGCACTCCAGCCTGGG
CAACAGAGCGAGACTCTTGTCTCAAGAAGAAGAAAAAAAGAAAAAGAAAAAGAAAAAGAAAAAACTTTTGATGCCAGTAGTTCTGTGAAGACAACAAAAA
AGCAGGGCTTTGAGAGAGAGCAATGAGGGCATAGGTGGCTGATTACATCAGATGGGTTAATCTCCAAGTGAAA

Expression



Full and truncated open reading frames discovered in TCONS_00253258

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.