Detailed information on ENST00000591627

lncRNA-RNA interactions

Number of interactions: 112

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263026 eukaryotic elongation factor-2 kinase protein coding ENST00000591627 641 291 UTR3 Trans
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000591627 651 286 UTR3 Trans
ENST00000280800 phospholipase B domain containing 2 protein coding ENST00000591627 616 308 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000591627 641 287 UTR3 Trans
ENST00000357613 transmembrane protein 170A protein coding ENST00000591627 614 277 UTR3 Trans
ENST00000418314 mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase protein coding ENST00000591627 503 247 CDS Trans
ENST00000432564 hydroxycarboxylic acid receptor 1 protein coding ENST00000591627 628 280 UTR3 Trans
ENST00000448612 WD repeat domain 27 protein coding ENST00000591627 612 293 CDS Trans
ENST00000473091 UBA domain containing 2 processed transcript ENST00000591627 607 290 noncoding Trans
ENST00000479069 bone morphogenetic protein receptor, type II (serine/threonine kinase) processed transcript ENST00000591627 557 288 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000591627 636 292 CDS_UTR Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000591627 544 280 noncoding Trans
ENST00000548404 transcribed_unprocessed_pseudogene processed transcript ENST00000591627 505 268 noncoding Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000591627 581 289 CDS_UTR Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay ENST00000591627 614 277 UTR3 Trans
ENST00000569540 transmembrane protein 170A protein coding ENST00000591627 614 277 UTR3 Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000591627 629 270 UTR3 Trans
ENST00000588483 tropomyosin 4 protein coding ENST00000591627 560 287 UTR5 Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000591627 602 288 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000591627 613 280 UTR3 Trans
TCONS_00050195 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000591627 608 288 UTR5 Trans
TCONS_00061180 golgin A2 pseudogene 5 novel protein coding ENST00000591627 505 268 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000591627 674 288 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000591627 628 288 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000591627 674 288 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000591627 628 288 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000591627 628 288 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000591627 674 288 UTR5 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000591627 610 273 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000591627 610 273 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000591627 534 287 UTR3 Trans
TCONS_00089062 eukaryotic elongation factor-2 kinase novel protein coding ENST00000591627 641 291 UTR3 Trans
TCONS_00089065 eukaryotic elongation factor-2 kinase novel protein coding ENST00000591627 641 291 UTR3 Trans
TCONS_00089066 eukaryotic elongation factor-2 kinase novel protein coding ENST00000591627 641 291 UTR3 Trans
TCONS_00089066 eukaryotic elongation factor-2 kinase novel protein coding ENST00000591627 611 292 UTR3 Trans
TCONS_00098745 transmembrane protein 170A novel protein coding ENST00000591627 614 277 UTR3 Trans
TCONS_00104867 hepatic leukemia factor novel protein coding ENST00000591627 601 279 UTR3 Trans
TCONS_00104871 hepatic leukemia factor novel protein coding ENST00000591627 601 279 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000591627 629 270 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000591627 619 278 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000591627 619 278 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000591627 644 288 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000591627 644 288 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000591627 604 288 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000591627 604 288 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000591627 604 288 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000591627 604 288 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000591627 604 288 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000591627 604 288 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000591627 604 288 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000591627 619 289 UTR3 Trans
TCONS_00118358 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000591627 605 277 UTR3 Trans
TCONS_00118361 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000591627 605 277 UTR3 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000591627 587 277 UTR3 Trans
TCONS_00123889 ribosomal protein SA pseudogene 58 novel protein coding ENST00000591627 636 283 UTR5 Trans
TCONS_00123899 ribosomal protein SA pseudogene 58 novel protein coding ENST00000591627 636 283 UTR5 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000591627 625 277 noncoding Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000591627 601 290 noncoding Trans
TCONS_00141404 GLI family zinc finger 2 novel protein coding ENST00000591627 631 278 UTR5 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000591627 607 280 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000591627 607 280 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000591627 631 279 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000591627 627 281 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000591627 631 279 UTR3 Trans
TCONS_00147106 ATPase family, AAA domain containing 2B novel protein coding ENST00000591627 631 279 UTR3 Trans
TCONS_00148698 WD repeat containing planar cell polarity effector novel noncoding ENST00000591627 691 274 noncoding Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000591627 691 274 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000591627 691 274 UTR3 Trans
TCONS_00150045 ankyrin repeat domain 36C novel protein coding ENST00000591627 609 277 UTR3 Trans
TCONS_00150051 ankyrin repeat domain 36C novel protein coding ENST00000591627 609 277 UTR3 Trans
TCONS_00150689 ectodysplasin A receptor novel protein coding ENST00000591627 601 291 UTR3 Trans
TCONS_00150696 septin 10 novel protein coding ENST00000591627 620 280 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000591627 651 286 UTR3 Trans
TCONS_00161618 interferon gamma receptor 2 (interferon gamma transducer 1) novel protein coding ENST00000591627 630 276 UTR3 Trans
TCONS_00168418 dual specificity phosphatase 18 novel protein coding ENST00000591627 614 287 UTR5 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000591627 609 268 noncoding Trans
TCONS_00173724 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000591627 603 290 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000591627 603 290 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000591627 623 291 UTR5 Trans
TCONS_00173730 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000591627 603 290 UTR5 Trans
TCONS_00180671 transketolase novel protein coding ENST00000591627 611 276 UTR5 Trans
TCONS_00180672 transketolase novel protein coding ENST00000591627 611 276 UTR5 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000591627 644 287 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000591627 632 288 UTR3 Trans
TCONS_00187473 spermatogenesis associated 18 novel noncoding ENST00000591627 608 289 noncoding Trans
TCONS_00190276 transmembrane protein 144 novel protein coding ENST00000591627 633 286 UTR3 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000591627 629 279 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000591627 629 279 UTR5 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000591627 636 292 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000591627 636 292 UTR3 Trans
TCONS_00196430 trio Rho guanine nucleotide exchange factor novel protein coding ENST00000591627 619 265 UTR3 Trans
TCONS_00196432 trio Rho guanine nucleotide exchange factor novel protein coding ENST00000591627 619 265 UTR3 Trans
TCONS_00197324 zinc finger, SWIM-type containing 6 novel protein coding ENST00000591627 612 285 UTR3 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000591627 680 289 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000591627 627 293 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000591627 585 296 UTR3 Trans
TCONS_00205414 prolyl 4-hydroxylase, alpha polypeptide II novel protein coding ENST00000591627 625 291 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000591627 635 279 UTR5 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000591627 642 288 UTR5 Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000591627 605 288 UTR5 Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000591627 616 291 UTR3 Trans
TCONS_00233179 BCL2/adenovirus E1B 19kDa interacting protein 3-like novel protein coding ENST00000591627 624 290 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000591627 611 290 UTR5 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000591627 630 274 UTR3 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000591627 624 287 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000591627 608 289 UTR5 Trans
TCONS_00244033 WNK lysine deficient protein kinase 2 novel protein coding ENST00000591627 603 280 UTR5 Trans
TCONS_00244038 WNK lysine deficient protein kinase 2 novel protein coding ENST00000591627 603 280 UTR5 Trans
TCONS_00244055 WNK lysine deficient protein kinase 2 novel protein coding ENST00000591627 603 280 UTR3 Trans
TCONS_00244067 WNK lysine deficient protein kinase 2 novel protein coding ENST00000591627 603 280 UTR5 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000591627 642 277 UTR5 Trans
TCONS_00251973 G protein-coupled receptor 34 novel protein coding ENST00000591627 602 288 UTR3 Trans

Sequence

>TCONS_00251973 (1460 nt)
CGGCCACAGTTTTTTTTTAAGCCCATAAATACTTCAGTGTGTGTCTCTAAAAGGAGGGTGATTCTGCCCCCTGGGGGACACTGGCAGTGTCTGGGGACAT
CTGTGCTTGTCACAGCTAAGGGTGCTTCTGGCATGGAGTGGGTTGGGGCAGGGACGCTGCTCAGCACCCTGCAGCGCCTAGGACAGCCCCACCTCAGAGA
ACAGTCTGGCCCCGACGTCCACAGGGCCGAGTGGGAGAGACTCTGCTCTGAACCGAATGGACTCTGTTAAAAATGTGTTTACCATAATCACAAAAGTAAA
AAATAGGGATGATTTCTTAATGTCAGGTATGTATTGTGTATTCAGGATACTCTTTTTTTTTTATAACAATAAACTTAAGGCCGGGTGTGGTGGCTCGCAT
CGGTAATTCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCATGAGGCCAGGAGCTTGAGACCAGCCTGGCCAACATGGTGAAACCCCGTTTCTACTAAAA
ATACAAAAATTAGCTGGGCGTGGTGGCGCGTACCTATAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCACCTGAACCCGGGAGGCAGAGGTTGCA
GTGAGCTGAGATTATGCCATTGCGCTCCAGCCTGGGCGACAGGGCGAGACTCTGTACCAGAAAAAACCGCCACCAAAAAAAAAACTTAAAATTTTTGAGA
AATGCTCTTGTGGGTTTGGGTCTTGCCTTTTCTTCTCTGCTTTTAGTGATCTGAGCTATTGTGTCTAGTCCGAAAGATAGTACTGATTTAATTAAGAAAC
ATCATTACAAGCAGGGATTCATGGACTAGGTTTGCACCTTCTGAACCATGAGCTAGACCATGTCTGGAGGCTGGAACCTGGTGACCCAGGCTCCCTGCGG
CCTTCTTAACCGCAGGCCACTTGGGGCCAGTTGGGCAGTGCCTGCTGCTATTGAGCCCCGTGCCCTCTCACAGGCCATCATCTGTGCGATCTCTGCGGTG
GACGAGGTGGACTACAAGACGGCTGAGGAGAAGTACATCAAGGGGCCTTCGCTGAGCTACCGGGAAAAAGAAATATTTGACAACCAGCTCCTTGAAGAGC
GGAACCGGCGCCGTCGGTGAGGGAGCAGCCGGCTGTGCTGTCAGCGGGGCCTGGCGGTGGAAGCGCCTCCAGTGTGCATGAGCGTGTCTGAAGATGGGGG
GCTCAGGGGGCACGTTTGCGTTTGGACCTGTCTGTGCGTTCTCCTGCGTGGCAGTCCTGATTTCCATGCTTCTGGAGAATCCATTTCGTTAACACTGAAA
GCCAGTTCTCTTTTCCTGGCAGTTTTTTTCATTTTATTTTTGGCATTTTTTACAAGATACCGTTCGGGAAAGGCTTTTGAAAGGACGGAAGCGTATTCAC
TGTGCGCCAGTACTCCTGGCTGTGCTGTGGTTTCTCCCGACGTGCACATCGATCTCGTATG

Expression



Full and truncated open reading frames discovered in TCONS_00251973

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.