Detailed information on ENST00000592381

lncRNA-RNA interactions

Number of interactions: 43

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000276431 tumor necrosis factor receptor superfamily, member 10b protein coding ENST00000592381 530 278 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000592381 538 285 noncoding Trans
ENST00000427746 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000592381 523 296 UTR5 Trans
ENST00000432564 hydroxycarboxylic acid receptor 1 protein coding ENST00000592381 631 284 UTR3 Trans
ENST00000473091 UBA domain containing 2 processed transcript ENST00000592381 555 295 noncoding Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000592381 615 291 CDS Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000592381 570 285 CDS_UTR Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000592381 629 284 UTR3 Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000592381 554 295 UTR3 Trans
TCONS_00023291 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000592381 500 259 UTR3 Trans
TCONS_00023292 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000592381 500 259 UTR3 Trans
TCONS_00023296 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000592381 500 259 UTR3 Trans
TCONS_00023298 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000592381 500 259 UTR3 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000592381 616 285 UTR3 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000592381 533 289 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000592381 616 285 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000592381 533 289 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000592381 632 302 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000592381 604 308 UTR3 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000592381 634 295 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000592381 634 295 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000592381 546 297 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000592381 601 295 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000592381 601 295 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000592381 629 284 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000592381 623 277 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000592381 623 277 UTR3 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000592381 621 292 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000592381 602 297 UTR5 Trans
TCONS_00141404 GLI family zinc finger 2 novel protein coding ENST00000592381 635 273 UTR5 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000592381 627 295 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000592381 609 294 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000592381 609 294 UTR3 Trans
TCONS_00147106 ATPase family, AAA domain containing 2B novel protein coding ENST00000592381 609 294 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000592381 607 283 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000592381 631 292 UTR5 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000592381 610 271 UTR5 Trans
TCONS_00224726 caldesmon 1 novel protein coding ENST00000592381 516 292 UTR3 Trans
TCONS_00224728 caldesmon 1 novel protein coding ENST00000592381 516 292 UTR3 Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000592381 621 295 UTR3 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000592381 600 285 UTR3 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000592381 649 296 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000592381 606 294 CDS_UTR Trans

Sequence

>TCONS_00240688 (1297 nt)
GGCGGAGAAGCAAAGGAGAGGGAAGCTGGAAGCACCTTTGGCCCGGGACAGAAATCTGGAGAGCTTGGCTACCTCCATCCTCCTCAGGCCGGAGCAGGCT
TCCTGAGAGAGTCCAGGTCGTAGGAGTTTTACGACTTAGAAAAGCGGGCTGCAGATTCCTTCCTGGGTGTTTGGTTCAAGCCTTGGCTCCAGCCTCACTC
TCAGTCTTCCCGGGAGTTCGTGGGATTTGGACCTTAGATTATTAGTATTATTTTGAGGGCCTCCTGTGTGTAAGCACTGGTTGTGCGCAGATGGCTGTGC
AGAGGGCCATGAGGTAGAGGCTGGGGAAATGAGGGCTTGGAGGTGCTTGAGGTATGGTCTTTACCTACGTGAAATGTTGGAGGTTGAGATGAAAACTCTT
GCTTTGAATTCTTCATGGAGGACTACATCATTTCAATCCTGAATCTGGCTCAATTCTATTATTCACTTATTACTGTATTAAAAACGTTTAATTGGCCAGG
CACAGTGGTTCACGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGCGGATCACTTGAGGTCAGGAGTTCGACACCAGCCTGGCCAACATGGCAAAA
CCCCGCCTCTACTAAAAATACAAAAATTAGCCAGGCGTGGTGGCACGCACCTGTAATCACAGCTACTTAGGAGGCTGAGGTGGCAGAATTGTTTGAACCC
AGGAGGTGGAGGTTGCAGTGAGCCGAGATCACACCACTGCACTCAAGCCTTGGCATCAGAGTGAGACTCTGTCTCAGTAAAAAAAAAATAAATAAATAAA
AATGTTTAATTAACCATGATATTTGCTTTGGTAAAACCTTTGAGGTTTAATGAGAATTTTAAAATTCATTATACTTTTCTTATGGCATATAAAAGTTTTA
ATTTTTTTTATTGTCTCAACTAACATCATAAATGTCTTAATGTTAAAATCCATGGGATATTCTATTTAAAATTTTAGCTTTATCACCTTTGTGCTATCAG
AGAATGTGCTTTGAACTGGTAAAATGAGTTAAAGTATTGGAAAACACTTATGTCAGCAGAGGCTCTTAAAAATCATTTTCATCCTTCCTCTTCTAGTGAT
GATTTTTTTTTAACCCATGTTTTCACCAGTCTACCAATCCAATGGCATAAATGCTCCTACATAGGCAACTTAAGTGTTTCTTAAGTTGATGCAAGGTATT
TTGCATGAGGCTGAATTCTTGTTGTCGGAGCAGAGGATTTTTGTTCCAACTACTGAATTGGCAAAATGTTAAATATAAAAACACCTCAAAAAGTCAAA

Expression



Full and truncated open reading frames discovered in TCONS_00240688

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.