Detailed information on ENST00000592423

lncRNA-RNA interactions

Number of interactions: 106

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000330676 TLC domain containing 2 protein coding ENST00000592423 686 280 UTR3 Trans
ENST00000334197 zinc finger protein 347 protein coding ENST00000592423 634 297 UTR3 Trans
ENST00000338977 zinc finger protein 721 protein coding ENST00000592423 623 277 UTR3 Trans
ENST00000343110 proline/arginine-rich end leucine-rich repeat protein protein coding ENST00000592423 600 296 UTR3 Trans
ENST00000345714 serum/glucocorticoid regulated kinase family, member 3 protein coding ENST00000592423 733 281 UTR3 Trans
ENST00000407780 inducible T-cell co-stimulator ligand protein coding ENST00000592423 662 302 UTR3 Trans
ENST00000482603 glyoxylate reductase/hydroxypyruvate reductase processed transcript ENST00000592423 581 277 noncoding Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000592423 575 301 noncoding Trans
ENST00000560870 sense_intronic sense intronic ENST00000592423 545 266 noncoding Trans
ENST00000592474 phosphoribosyl pyrophosphate synthetase-associated protein 1 retained intron ENST00000592423 662 286 noncoding Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000592423 679 266 UTR3 Trans
ENST00000620340 ribosomal protein S6 kinase, 90kDa, polypeptide 6 protein coding ENST00000592423 643 284 UTR3 Trans
ENST00000621141 G protein-coupled receptor 1 protein coding ENST00000592423 584 292 UTR3 Trans
TCONS_00006772 lincRNA novel protein coding ENST00000592423 612 289 UTR3 Trans
TCONS_00008385 nitric oxide synthase 1 (neuronal) adaptor protein novel protein coding ENST00000592423 689 290 UTR3 Trans
TCONS_00009834 SRY (sex determining region Y)-box 13 novel protein coding ENST00000592423 627 291 UTR3 Trans
TCONS_00010841 epoxide hydrolase 1, microsomal (xenobiotic) novel protein coding ENST00000592423 684 298 UTR3 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding ENST00000592423 631 298 UTR3 Trans
TCONS_00021902 protein tyrosine phosphatase, non-receptor type 14 novel protein coding ENST00000592423 684 300 UTR3 Trans
TCONS_00021903 protein tyrosine phosphatase, non-receptor type 14 novel protein coding ENST00000592423 684 300 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000592423 658 286 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000592423 677 295 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000592423 630 296 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000592423 630 296 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000592423 677 295 UTR3 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000592423 653 300 UTR5 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000592423 653 300 UTR5 Trans
TCONS_00043422 vacuolar protein sorting 37 homolog C (S. cerevisiae) novel protein coding ENST00000592423 698 297 UTR5 Trans
TCONS_00058750 lincRNA novel protein coding ENST00000592423 631 282 UTR3 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000592423 668 276 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000592423 668 276 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000592423 678 298 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000592423 668 276 UTR5 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000592423 715 267 UTR3 Trans
TCONS_00065864 long intergenic non-protein coding RNA 412 novel protein coding ENST00000592423 746 276 UTR3 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000592423 610 268 UTR3 Trans
TCONS_00075840 forkhead box N3 novel protein coding ENST00000592423 628 273 UTR3 Trans
TCONS_00075841 forkhead box N3 novel protein coding ENST00000592423 628 273 UTR3 Trans
TCONS_00088780 synaptotagmin XVII novel protein coding ENST00000592423 632 271 UTR3 Trans
TCONS_00104867 hepatic leukemia factor novel protein coding ENST00000592423 630 282 UTR3 Trans
TCONS_00104871 hepatic leukemia factor novel protein coding ENST00000592423 630 282 UTR3 Trans
TCONS_00116334 low density lipoprotein receptor class A domain containing 4 novel protein coding ENST00000592423 636 270 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000592423 539 269 UTR3 Trans
TCONS_00117136 CBP80/20-dependent translation initiation factor novel protein coding ENST00000592423 638 282 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000592423 623 283 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000592423 635 284 UTR5 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding ENST00000592423 621 264 UTR5 Trans
TCONS_00133831 carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) novel protein coding ENST00000592423 708 301 UTR3 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000592423 687 304 UTR3 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000592423 634 297 UTR3 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding ENST00000592423 603 289 UTR3 Trans
TCONS_00148387 reticulon 4 novel protein coding ENST00000592423 690 283 UTR3 Trans
TCONS_00148389 reticulon 4 novel protein coding ENST00000592423 690 283 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000592423 652 303 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000592423 709 280 UTR3 Trans
TCONS_00150627 UDP-glucuronate decarboxylase 1 novel protein coding ENST00000592423 607 297 UTR5 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000592423 641 277 UTR5 Trans
TCONS_00163367 runt-related transcription factor 1 novel protein coding ENST00000592423 629 292 UTR3 Trans
TCONS_00163891 inducible T-cell co-stimulator ligand novel protein coding ENST00000592423 662 302 UTR3 Trans
TCONS_00175724 TSC22 domain family, member 2 novel protein coding ENST00000592423 698 295 UTR3 Trans
TCONS_00182613 processed_transcript novel protein coding ENST00000592423 643 291 UTR5 Trans
TCONS_00182614 processed_transcript novel protein coding ENST00000592423 643 291 UTR5 Trans
TCONS_00185516 transcribed_unprocessed_pseudogene novel protein coding ENST00000592423 651 274 UTR5 Trans
TCONS_00185519 transcribed_unprocessed_pseudogene novel protein coding ENST00000592423 651 274 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000592423 622 288 UTR5 Trans
TCONS_00187165 NEDD4 binding protein 2 novel protein coding ENST00000592423 673 287 UTR3 Trans
TCONS_00189321 transcribed_unprocessed_pseudogene novel protein coding ENST00000592423 688 302 UTR5 Trans
TCONS_00189329 transcribed_unprocessed_pseudogene novel protein coding ENST00000592423 688 302 UTR5 Trans
TCONS_00189333 transcribed_unprocessed_pseudogene novel protein coding ENST00000592423 688 302 UTR5 Trans
TCONS_00189336 transcribed_unprocessed_pseudogene novel protein coding ENST00000592423 688 302 UTR5 Trans
TCONS_00189341 transcribed_unprocessed_pseudogene novel protein coding ENST00000592423 688 302 UTR5 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000592423 665 281 UTR5 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000592423 623 277 UTR3 Trans
TCONS_00192159 amyloid beta (A4) precursor protein-binding, family B, member 2 novel protein coding ENST00000592423 505 232 UTR3 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000592423 650 303 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000592423 650 303 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000592423 647 303 UTR3 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000592423 633 302 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000592423 736 303 UTR3 Trans
TCONS_00195633 aspartylglucosaminidase novel protein coding ENST00000592423 584 277 UTR3 Trans
TCONS_00195828 LRP2 binding protein novel protein coding ENST00000592423 632 293 UTR5 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000592423 617 282 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000592423 619 274 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000592423 667 290 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000592423 619 274 UTR5 Trans
TCONS_00203988 family with sequence similarity 169, member A novel noncoding ENST00000592423 667 290 noncoding Trans
TCONS_00204896 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000592423 648 303 UTR5 Trans
TCONS_00204911 erythrocyte membrane protein band 4.1 like 4A novel noncoding ENST00000592423 712 307 noncoding Trans
TCONS_00204916 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000592423 712 307 UTR3 Trans
TCONS_00206432 SH3 domain and tetratricopeptide repeats 2 novel protein coding ENST00000592423 606 303 UTR3 Trans
TCONS_00206433 SH3 domain and tetratricopeptide repeats 2 novel protein coding ENST00000592423 606 303 UTR3 Trans
TCONS_00213738 enoyl-CoA delta isomerase 2 novel protein coding ENST00000592423 626 264 UTR3 Trans
TCONS_00216910 high mobility group nucleosomal binding domain 3 novel noncoding ENST00000592423 624 297 noncoding Trans
TCONS_00230811 kielin/chordin-like protein novel protein coding ENST00000592423 613 304 UTR3 Trans
TCONS_00232466 tumor suppressor candidate 3 novel protein coding ENST00000592423 504 280 UTR3 Trans
TCONS_00232467 tumor suppressor candidate 3 novel protein coding ENST00000592423 504 280 UTR3 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000592423 646 298 UTR5 Trans
TCONS_00240832 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 novel protein coding ENST00000592423 707 277 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000592423 634 301 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000592423 634 301 UTR5 Trans
TCONS_00244030 WNK lysine deficient protein kinase 2 novel protein coding ENST00000592423 648 302 UTR3 Trans
TCONS_00244033 WNK lysine deficient protein kinase 2 novel protein coding ENST00000592423 648 302 UTR5 Trans
TCONS_00244038 WNK lysine deficient protein kinase 2 novel protein coding ENST00000592423 648 302 UTR5 Trans
TCONS_00244055 WNK lysine deficient protein kinase 2 novel protein coding ENST00000592423 648 302 UTR3 Trans
TCONS_00244067 WNK lysine deficient protein kinase 2 novel protein coding ENST00000592423 648 302 UTR5 Trans
TCONS_00248986 transmembrane protein 246 novel protein coding ENST00000592423 574 316 UTR3 Trans

Sequence

>TCONS_00248986 (2810 nt)
CCGATGCCACACCAAATGGCTAGAGGGTGTGTTTGGGATGACCTGAGTCTGGTAGGCAACTTCCAGTGGACCCCACGGTGCGACCACCTCCCTTTGAGTG
TGGGGGAGATGTAGCGACTGGCTTCTAGCAGTAGGATAGGGCAGAAGTGACAGTAGGTTAGTCTTGTGGTTAGGTTACAAAACTGACCTCTGTGATGGTA
GCGTCCCTCGTCAGCCCTCTTGTCTTGCCCTCTCGCTGGCTGGTGGTGATGGAGCCGGCTGCCATGGTGAGCGGCCCTGTGGAGAAGCCAGGGAGGAATG
GAGACAATCTGGAGAAACAGAATCACACCAACAACCACGTGCGTGAGCTTGCTGTGTGCTCTTGCTTGGGAGCAAGTTACAGGTTCAGCCCAAGAGGAGC
GGACCACTCCAGGGTGTAAATACCAGGAGGGGGAATTGGAAGACTACCCTAAGCATGCCGACCGGAGACTGTGTGTGTGTAGTAGGTATTTCTTACTGGG
AGATCACGGAAAAGCAAGTTTGAGAAACACTCCCATCAGATGGGTGGGCCGAGGATAACCTCAAAGCCTTTGGTTCTCCGAATAGGTGCGTAGGACTCAC
CCAGGCACTCTTTCCTTTTTTAAATTGTGGTAAAAACTACATAACAGTGGCCAGGCGTGATGGTGCACGCCTGTAATCCCAGCTATTAGGGAGGCTGAGG
CAGAAGAACTGCTTGAACCAAGGGGGCACCGCTCCTGGCTGTAACATGTTTTCAATATCCCCCCTCTTCGGTGGCACAGGGGCTGGCCCCATATACATGT
GCGATGGCAACTGACAGGGTCCCTGATAAACCGGAGTGCTCCAGAAACACCCCATTGCGTGGGACGGAGGATGTTAGGTGGCCCTCCTAGCGTTTGAGTT
TGATAAATGAGCAAAGGAAGTGGTTTTTACTAGAAAGCCAGCTTTCCTTTTTTTTTTTTTTTTTTTTCCAGCCAGCAAACCCCAAACAGGAACCTATGGT
TGGTGATGGATGTGCGTTCAGAAAGCAGGGAGGGAGGGGGAGTCAGAGGTGAGGGGGTCATCAGCCATAGCTGTCCGCTGCATCACCCCCTCGCTATCTC
CAGGAAGCGTTCTGGGCTTTTCCTGTTGTGCAGTGTGGAAGTGCTCTATCTTCATTCATATCAAGGAAAGTCAAAGGACAAACTAAAGCCGGCAGCGTCT
TTCTGGCTTCCTAGTCAGGCTGTTCGGTAGCGGAGTGTCACCCTGATTTCCAGCCCCGCAGCACACACAGTGAGAGCCTGCCTGGCGTGATTCAGAGGCA
ACGTATTTCCCAAGGTGGCTGTGAAGGAACCAGGGGGATAAACACAGCCCGTGAACCGCACGCCAGAGGACAGGTCCGGCTGCCTGCCGCGGAGTCGTCA
CGGCGTGTCGCGTCTGAGCGCTTCTCCAAAGCACCCAAGTGGCACCCGGGGTGACAGTTACATCATCTTGAGTACAGTTCTCTCAAGGAAAAAGCAAGCC
CAGCATCTTCTGCCATGGCAACCCTGGCTTGGAGCCTCCATAAGAGAGAAGGCCCTAAGAATAATACCATTTTCTTGCTCTAAGTTGCTCTTACGGGAAA
GAAGTGATAATATTCTTCCTAAACGCCATCATTCGTGCATCCTTCCCACCTATATGTGTCACCGGATCATTCTCCGCCTGGGCGGGGCCGTCCTGTGCAC
TGCAGAATGCTGAGCAGTGTCCTTGGCTTCGACCGACCACATGCCAGGAGCACCCCAATTTCTGCCATCGGGTGATTGACTTCACTGTTGCATTTGATTT
TTTATGTATCTTTTAAAAGGACCCAATAGGGCCAGGCACAGTGGCTCACACTTGTAATCCCAGCACTTTGGGAGGCTGAGGTCGGTGGATTGCTTGAGCC
CAGGAGGAGTTCAAGACCAGCCTGGGCAACATAGTGAAACCCCAACTCTACAAAAAACAAATGTTTTATTTTTATTTATTTTAGATGGAGTTTCACTCTT
GTTGCCCAGGCTGGAGTGCAGTGGCGCAATCTCGGCTCACTGCAACTTCTGCCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTATCTGGG
ATTACAGGCATGCGCCACCACACCCAGCTAATTTTGTATTTTTAGTAGAGATGGCGTTTCTCCATGTTGGTCAGGCTGGTCTCAAACTCCCGACCTCAGG
TGATCTGCCTGCCTCGGCCTCCCAGAGTGTTGGGATTACAGGCGTGAGCCACCACGCCCAGCCGGGTTTATAGTTTTATAACCCTTATGACAAATCTCAT
AGTATTCTGCAGGGATAAGCATGAAACCACTCGTTCAATAAGTGCAAACAAAAACGCCAACAATTCTTAAGACATTTCTAATCTTATTTTACCAATAATT
TTAAAGCCAGCTTATGTATTAAAGATTTATAACTACTTTTATTAACACGTTTAAAATTCTATGCAGCTTAAAGCATTTATAATGGATAAAACTGCCAATA
CTGAGTGCCTGACATAATATTTGAAAGGTGGCAGGCATTCAACCATGGTCACTGAATGAGAGATGTAGGGAAGATGATGGCAGGGAGGTTTTTAGATATC
AACACCCTGATAGTTCTCATTTTAACCACCTGTAAGTGCACATACAAGTCAACGCCACTGTGCCTGGCTGATTTTTATTCTTTTAGTTAAGGCTGGTTGA
TATTACCTTGTGTGTATATACCACATGTTGTTTATCCATTGTTGTTGATGGACATGTGGGTGGTTTCACCTTTTGGCTATTGTGAATAAAGCTGCTATGA
ACACTGTGTAC

Expression



Full and truncated open reading frames discovered in TCONS_00248986

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.