Detailed information on ENST00000594592

lncRNA-RNA interactions

Number of interactions: 97

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000232564 guanine nucleotide binding protein (G protein), beta polypeptide 4 protein coding ENST00000594592 640 273 UTR3 Trans
ENST00000330676 TLC domain containing 2 protein coding ENST00000594592 635 260 UTR3 Trans
ENST00000339732 polypeptide N-acetylgalactosaminyltransferase 15 protein coding ENST00000594592 653 270 UTR3 Trans
ENST00000367590 xenotropic and polytropic retrovirus receptor 1 protein coding ENST00000594592 552 250 UTR3 Trans
ENST00000389534 zinc finger protein 841 protein coding ENST00000594592 616 261 UTR3 Trans
ENST00000391877 delta(4)-desaturase, sphingolipid 1 protein coding ENST00000594592 565 276 UTR3 Trans
ENST00000407780 inducible T-cell co-stimulator ligand protein coding ENST00000594592 602 266 UTR3 Trans
ENST00000426391 zinc finger protein 841 protein coding ENST00000594592 616 261 UTR3 Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000594592 620 276 UTR5 Trans
ENST00000448214 antisense antisense ENST00000594592 534 287 noncoding Trans
ENST00000560870 sense_intronic sense intronic ENST00000594592 594 270 noncoding Trans
ENST00000591226 tropomyosin 4 retained intron ENST00000594592 651 282 noncoding Trans
ENST00000594295 zinc finger protein 841 protein coding ENST00000594592 616 261 UTR3 Trans
TCONS_00000504 adherens junctions associated protein 1 novel protein coding ENST00000594592 622 268 UTR3 Trans
TCONS_00001821 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000594592 662 280 UTR5 Trans
TCONS_00001821 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000594592 665 270 UTR3 Trans
TCONS_00001823 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000594592 662 280 UTR5 Trans
TCONS_00001823 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000594592 665 270 UTR3 Trans
TCONS_00009095 xenotropic and polytropic retrovirus receptor 1 novel protein coding ENST00000594592 552 250 UTR3 Trans
TCONS_00009834 SRY (sex determining region Y)-box 13 novel protein coding ENST00000594592 688 270 UTR3 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding ENST00000594592 631 285 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000594592 667 276 UTR3 Trans
TCONS_00030165 antisense novel protein coding ENST00000594592 534 287 UTR5 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000594592 653 270 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000594592 682 306 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000594592 682 306 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000594592 653 270 UTR3 Trans
TCONS_00033132 dynein heavy chain domain 1 novel protein coding ENST00000594592 605 284 UTR5 Trans
TCONS_00051891 RNA binding motif, single stranded interacting protein 2 novel protein coding ENST00000594592 657 306 UTR3 Trans
TCONS_00053503 anoctamin 4 novel protein coding ENST00000594592 622 285 UTR3 Trans
TCONS_00053513 anoctamin 4 novel protein coding ENST00000594592 622 285 UTR5 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000594592 661 269 UTR3 Trans
TCONS_00075840 forkhead box N3 novel protein coding ENST00000594592 631 309 UTR3 Trans
TCONS_00075841 forkhead box N3 novel protein coding ENST00000594592 631 309 UTR3 Trans
TCONS_00085508 neuregulin 4 novel noncoding ENST00000594592 636 288 noncoding Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000594592 700 285 UTR5 Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000594592 607 267 UTR5 Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000594592 611 289 UTR5 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000594592 614 286 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000594592 700 285 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000594592 607 267 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000594592 611 289 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000594592 614 286 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000594592 700 285 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000594592 607 267 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000594592 611 289 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000594592 614 286 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000594592 700 285 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000594592 607 267 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000594592 611 289 UTR3 Trans
TCONS_00101169 myosin phosphatase Rho interacting protein novel protein coding ENST00000594592 560 255 UTR3 Trans
TCONS_00105791 arylsulfatase G novel protein coding ENST00000594592 622 285 UTR3 Trans
TCONS_00114623 glutamine rich 2 novel protein coding ENST00000594592 643 275 UTR5 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding ENST00000594592 643 275 UTR5 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000594592 654 303 UTR3 Trans
TCONS_00118582 centrosomal protein 76kDa novel protein coding ENST00000594592 637 269 UTR3 Trans
TCONS_00119477 zinc finger and BTB domain containing 7C novel protein coding ENST00000594592 605 282 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000594592 644 273 UTR5 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding ENST00000594592 664 270 UTR5 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000594592 616 261 UTR3 Trans
TCONS_00135644 zinc finger protein 841 novel protein coding ENST00000594592 616 261 UTR3 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000594592 647 304 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000594592 604 260 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000594592 627 257 UTR3 Trans
TCONS_00150696 septin 10 novel protein coding ENST00000594592 644 273 UTR3 Trans
TCONS_00163367 runt-related transcription factor 1 novel protein coding ENST00000594592 635 270 UTR3 Trans
TCONS_00163891 inducible T-cell co-stimulator ligand novel protein coding ENST00000594592 602 266 UTR3 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000594592 606 303 UTR5 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000594592 620 297 noncoding Trans
TCONS_00184486 guanine nucleotide binding protein (G protein), beta polypeptide 4 novel protein coding ENST00000594592 640 273 UTR3 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000594592 629 263 UTR5 Trans
TCONS_00185516 transcribed_unprocessed_pseudogene novel protein coding ENST00000594592 626 258 UTR5 Trans
TCONS_00185519 transcribed_unprocessed_pseudogene novel protein coding ENST00000594592 626 258 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000594592 628 303 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000594592 605 305 UTR3 Trans
TCONS_00195633 aspartylglucosaminidase novel protein coding ENST00000594592 606 286 UTR3 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000594592 625 296 UTR3 Trans
TCONS_00199320 sorting nexin 24 novel noncoding ENST00000594592 660 286 noncoding Trans
TCONS_00200504 Rho GTPase activating protein 26 novel protein coding ENST00000594592 623 304 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000594592 643 270 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000594592 646 270 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000594592 646 270 UTR5 Trans
TCONS_00211226 antisense novel protein coding ENST00000594592 638 268 UTR3 Trans
TCONS_00211226 antisense novel protein coding ENST00000594592 616 283 UTR5 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000594592 622 284 UTR5 Trans
TCONS_00213738 enoyl-CoA delta isomerase 2 novel protein coding ENST00000594592 627 286 UTR3 Trans
TCONS_00214410 processed_pseudogene novel protein coding ENST00000594592 605 273 UTR5 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000594592 607 286 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000594592 607 275 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000594592 610 262 UTR5 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000594592 609 294 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000594592 610 262 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000594592 609 294 UTR5 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000594592 648 281 UTR3 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000594592 616 306 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000594592 656 302 UTR5 Trans
TCONS_00253055 uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) novel protein coding ENST00000594592 607 273 UTR3 Trans

Sequence

>TCONS_00253055 (1256 nt)
GTTACTTCTTCTTTTTTTATTTTATTTTAATTGAGACAGCATCTCGCTCTGTCACCTGGGCTGGAGTGCAGTGGCACGATCTCGGCTCACTGCAACCTCT
GCCTCCCGGGTTCAAGCGATTTTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGGGTGCGCTACCATGCCCGGCTAATTTTTGTATTTTTAGTAAA
GACGGGGTTTCACCATGTTGGCCAAGCTGGTCTCGAACTCTTGACTTCAGGTGATCCGCCCACCTCGGCCTCCCAAAGTGCTGGGACCACAGGTGTGAGC
CACCGTGCCTGACCTATTTTGTTACTTCTTGAAGCGGGTAACACCACTACTGTCATCCGATGGTGAGATGGGGACCAGGAAACAGTCACAAAGAAAACAC
CGACCCCTCCTCCGTGGAGCTCACGGTCAGCTGGGTGGTCAGAGTTCGAAATGAATAACAGAGTCCAGTGGAAGTGTGTTATACAAGGACTTCATCTCAG
GGGACGGGAGAGTTCTGGGAAAGGATGGATATTTAAGCTTAGGCCAGGGTTTCTCAACTGCAGCACTGCTGATAATGGGCTACTGCAGCACTGCTGATAA
TGGGCCTGTTCACTCTCAGCTGTGGGCCGTCCTGTGCATTATAGGATGCTGAGCAGCATCCCTGGCCTCAACTCACTAGATGCTACGAGCACTTTTCCTC
TATGAGTTTGCTAGGGCTGCCATATCAAAGTTCCACCAGCTGGGTGGATTAAACAGCAAAAATATATTGTCTCACCGTTCTGGAGGCCAGAAGCTCGAGA
GCAAGGTGTTGGCAGTGTTGGTTCCTTTTGAAGCCTCTCCTTGGTGTGTAGATGGCCATCTTCTCTCTATATCTTCACATCATCTTCCCTCTGTCCATGT
CTGTGTCCAAATGTCGTCTTCTTGTGATAGGGTTTGGATTTGTGTCCCCACCTAAATCTCATGTCAAATTGTAATCTCCAGTGTTGGAGGAAGGGCTTGG
TGGGAGGTGACTGGATCATGGGGGTGGACTTCCCCCTTGCTGTTCTCTTGATAGTGAGTGAGTTCTCACGAGATCTGGTTGTTTAAAAGTGTGTAGCACC
TCCCCCTTCACTCTCTTCCTCCTGCTCCAGCCATGTAGCACGTGCCTGCTTCCCCTTTGCCTTCCGCCATGATTGTAAGTTTCTCGAGTCCTCCCCAGCC
ATGCGTCCTGTACAACCTGTGGAACCAGGAGCCAATTAAACCTCTTTTCTTTATAAA

Expression



Full and truncated open reading frames discovered in TCONS_00253055

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.