| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000263955 | serine/threonine kinase 17b | protein coding | ENST00000594821 | 585 | 284 | UTR3 | Trans | |
| ENST00000276431 | tumor necrosis factor receptor superfamily, member 10b | protein coding | ENST00000594821 | 517 | 280 | UTR3 | Trans | |
| ENST00000427746 | holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) | protein coding | ENST00000594821 | 506 | 282 | UTR5 | Trans | |
| ENST00000494969 | colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) | protein coding | ENST00000594821 | 612 | 285 | CDS | Trans | |
| ENST00000517408 | antisense | antisense | ENST00000594821 | 505 | 289 | noncoding | Trans | |
| ENST00000549365 | DNA-damage regulated autophagy modulator 1 | nonsense mediated decay | ENST00000594821 | 500 | 289 | CDS_UTR | Trans | |
| ENST00000568559 | transmembrane protein 170A | nonsense mediated decay | ENST00000594821 | 539 | 283 | UTR3 | Trans | |
| TCONS_00030130 | calcium/calmodulin-dependent protein kinase II gamma | novel protein coding | ENST00000594821 | 647 | 294 | UTR3 | Trans | |
| TCONS_00067572 | DCN1, defective in cullin neddylation 1, domain containing 2 | novel protein coding | ENST00000594821 | 608 | 288 | UTR3 | Trans | |
| TCONS_00109011 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000594821 | 508 | 285 | UTR5 | Trans | |
| TCONS_00119512 | zinc finger and BTB domain containing 7C | novel protein coding | ENST00000594821 | 613 | 288 | UTR3 | Trans | |
| TCONS_00153158 | serine/threonine kinase 17b | novel protein coding | ENST00000594821 | 585 | 284 | UTR3 | Trans | |
| TCONS_00168219 | THO complex 5 | novel protein coding | ENST00000594821 | 563 | 273 | UTR3 | Trans | |
| TCONS_00168220 | THO complex 5 | novel protein coding | ENST00000594821 | 563 | 273 | UTR3 | Trans | |
| TCONS_00173729 | cms1 ribosomal small subunit homolog (yeast) | novel protein coding | ENST00000594821 | 600 | 297 | UTR5 | Trans | |
| TCONS_00199319 | sorting nexin 24 | novel noncoding | ENST00000594821 | 512 | 272 | noncoding | Trans |
>TCONS_00199319 (477 nt)
ATTATATACGAGTATAAATGAAATTCATTTCTAAATTCTTAATAAATATTTTCTCATGCCAGGTGTGGTGGCTCACGTCTGTAATCCCAGCACTTTGACA
GGCTGAGCGAGGGAGTGGATCTTGAGGTCAGCAGTTCGAGACCAGCATGGCCAATATGGAGAAATCCCGTCTCTACTAAAAATACAAAAATTAGCCAGGC
GTGGTGGCATGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCGCTTGAACCTGGGAGGTGGAGGTTGCAATGAGCCAAGATCACCCCA
CTGCACTCCAGCCTGGGCAACAGAGCGAGACTCCATCTCAAAAAGCCAGGAGTGGTGGCTCACACCTGTAATCCCAGCTCTGGGAGGCCAAGGCCAGTGG
ATTGCTTGAGCCCAGGAGTTTGAGACCAGCCTGGACAACGTGGAAAAACCCCATCTCTACTAAAAATACAAAAACAAC
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.