| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000378004 | Rho GTPase activating protein 26 | protein coding | ENST00000595825 | 565 | 255 | UTR3 | Trans | |
| ENST00000424496 | sense_intronic | sense intronic | ENST00000595825 | 569 | 250 | noncoding | Trans | |
| ENST00000524750 | CD82 molecule | protein coding | ENST00000595825 | 523 | 231 | UTR3 | Trans | |
| TCONS_00030130 | calcium/calmodulin-dependent protein kinase II gamma | novel protein coding | ENST00000595825 | 662 | 254 | UTR3 | Trans | |
| TCONS_00030588 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000595825 | 607 | 255 | UTR3 | Trans | |
| TCONS_00050195 | FYVE, RhoGEF and PH domain containing 4 | novel protein coding | ENST00000595825 | 605 | 269 | UTR5 | Trans | |
| TCONS_00050741 | spermatogenesis associated, serine-rich 2 | novel protein coding | ENST00000595825 | 621 | 254 | UTR3 | Trans | |
| TCONS_00108999 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000595825 | 622 | 255 | UTR5 | Trans | |
| TCONS_00109000 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000595825 | 622 | 255 | UTR5 | Trans | |
| TCONS_00109009 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000595825 | 622 | 255 | UTR5 | Trans | |
| TCONS_00109011 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000595825 | 622 | 255 | UTR5 | Trans | |
| TCONS_00109012 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000595825 | 622 | 255 | UTR5 | Trans | |
| TCONS_00109013 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000595825 | 622 | 255 | UTR5 | Trans | |
| TCONS_00109014 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000595825 | 622 | 255 | UTR5 | Trans | |
| TCONS_00116668 | desmoglein 3 | novel protein coding | ENST00000595825 | 618 | 248 | UTR3 | Trans | |
| TCONS_00116668 | desmoglein 3 | novel protein coding | ENST00000595825 | 616 | 255 | UTR3 | Trans | |
| TCONS_00150696 | septin 10 | novel protein coding | ENST00000595825 | 617 | 256 | UTR3 | Trans | |
| TCONS_00165085 | SPECC1L-ADORA2A readthrough (NMD candidate) | novel protein coding | ENST00000595825 | 621 | 255 | UTR3 | Trans | |
| TCONS_00165089 | SPECC1L-ADORA2A readthrough (NMD candidate) | novel protein coding | ENST00000595825 | 621 | 255 | UTR3 | Trans | |
| TCONS_00165090 | SPECC1L-ADORA2A readthrough (NMD candidate) | novel protein coding | ENST00000595825 | 621 | 255 | UTR3 | Trans | |
| TCONS_00165341 | TTC28 antisense RNA 1 | novel protein coding | ENST00000595825 | 633 | 256 | UTR5 | Trans | |
| TCONS_00194652 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000595825 | 602 | 250 | UTR5 | Trans | |
| TCONS_00194655 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000595825 | 602 | 250 | UTR5 | Trans | |
| TCONS_00194682 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000595825 | 644 | 264 | UTR3 | Trans | |
| TCONS_00194686 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000595825 | 644 | 264 | UTR3 | Trans | |
| TCONS_00222403 | protein tyrosine phosphatase, non-receptor type 12 | novel protein coding | ENST00000595825 | 600 | 259 | UTR5 | Trans | |
| TCONS_00227594 | GLI family zinc finger 3 | novel protein coding | ENST00000595825 | 557 | 211 | UTR3 | Trans |
>TCONS_00227594 (561 nt)
ATTGTCTCTCGCTGACGCCAGAGATCCAGCTATCGTCTTCACTGCTCTGTGCCGTCAGCTCCTAGAGGCCCAGCCTCTGTGGCCCTGTGACCTGCAGGTA
TTAGGAGGGTCACAGCTAGGACGCCGGGACCCCCTGGAAGCCTAGAAATGGTTGGCGTGCAGTCTCGCGATCTCCGCTCACCGCAAGCTCCGCCTCCTGG
GTTCACGCCATTCTCCTGCCTCAGCCTCCCCAGTAGCTGGGACTACAGGCGCCCGCCACTACGCCCGCCTAATTTTTTGTATTTTTAGTAGAGATGGGTT
TCACCGTGTTAGCCAGGATGGTCTCGATCTCCTGACCTTGTGATCCACCCGCCTCAGCCTCCCAAATTGCTGGGATTACAGGCGTGAGCCACCGCGCCCA
GCCTAGTTAGGTAGTTTTTAAATTTGTACAATCGAGATGGAAATTTCCTGGTTATGTAATCAGAGTTTAATTGGCAGTTTATAGTTGCTTAAGCCTGAAT
TTTGTTTCCCCTAATGTAGTAATTTACCAAAGAATACACTTGAGTTTTGTTTTTTTTCCTTA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.