Detailed information on ENST00000603061

lncRNA-RNA interactions

Number of interactions: 37

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263026 eukaryotic elongation factor-2 kinase protein coding ENST00000603061 541 298 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding ENST00000603061 608 295 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000603061 508 293 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000603061 601 305 noncoding Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay ENST00000603061 551 268 UTR3 Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000603061 516 308 UTR3 Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000603061 545 262 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000603061 629 292 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000603061 500 285 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000603061 500 285 UTR3 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000603061 601 305 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000603061 601 305 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000603061 601 305 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000603061 601 305 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000603061 601 305 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000603061 601 305 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000603061 601 305 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000603061 601 305 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000603061 602 295 UTR3 Trans
TCONS_00089062 eukaryotic elongation factor-2 kinase novel protein coding ENST00000603061 541 298 UTR3 Trans
TCONS_00089065 eukaryotic elongation factor-2 kinase novel protein coding ENST00000603061 541 298 UTR3 Trans
TCONS_00089066 eukaryotic elongation factor-2 kinase novel protein coding ENST00000603061 541 298 UTR3 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding ENST00000603061 608 295 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding ENST00000603061 608 295 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding ENST00000603061 608 295 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000603061 516 308 UTR3 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000603061 507 296 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000603061 668 295 UTR3 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000603061 590 286 UTR5 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000603061 653 295 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000603061 653 295 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000603061 653 295 UTR5 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000603061 624 288 UTR3 Trans
TCONS_00189916 doublecortin-like kinase 2 novel protein coding ENST00000603061 509 304 UTR3 Trans
TCONS_00189917 doublecortin-like kinase 2 novel protein coding ENST00000603061 509 304 UTR3 Trans
TCONS_00189925 doublecortin-like kinase 2 novel protein coding ENST00000603061 509 304 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000603061 649 296 UTR3 Trans

Sequence

>TCONS_00240688 (835 nt)
CTAGCAAGGAGGCCAGTGCAGCTGGAGTGTGGAAATGGAGGAAGTTGGAGGTAGACAAATTATGTGAGGCCACAGTAAGGTTTTGGGACTTTATTCTGAG
GATGACGAGAAACCAGTTGAGGATTTTCAGCAGAAATGTGAAGTAACCCCCGCCCCCCGGCCTGGTGTTTTAAAAGAACTACTCTGGCTGCTTTGTAGAG
AACTGCGTGGTTTGAAAGGAGCACCCAAGGTGAGCAAAAAGACCTGCACTTTATGCTACTCTCACTTAACTCACTCTAGGGCTGTGTGCCTCAATTCTTT
GCCTATAAAATGGAGGTGAGAGTGGCCGGGCATGTTGGCTCACGCCTGTAATCCCAGCAATTTGGGAGGCCGAGGCAGGCAGATCACCTGAGGTCAGGAG
TTTGAGACCAGCCTGACCAATATGATGAAACCCCCATCTCCACTAAAAATACAAAAATTAGCCGGGCGTGGTGGCATGTGCCTGTAATCCCAGCTACTTG
GGCGGCTGAGACAGGAGAGTCGCTTGAACCCGGGAGGCGGAGGTTTCAGTGAGCTGAGTTTGCACCATTGCACTCCAGCCTGGGCAACAAGAGCGAAACT
CCGTCTGAAAAAAAAAAATGGAGGTGTTCCCTTCCCAAAGAACTTCCTTCAGATCTGCAAGAAGATCCTGTGCCGCCTTTTCCGGGTCTTTGTCCACGTC
TATATCCACCACTTCGACCGGGTCATTGTGATGGGTGCAGAGGCCCATGTCAACACCTGCTACAAACACTTCTATTACTTTGTCACAGAGATGAACCTCA
TAGACCGCAAGGAGCTAGAGCCTTTGGTAAGTGACA

Expression



Full and truncated open reading frames discovered in TCONS_00240688

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.