Detailed information on ENST00000604716

lncRNA-RNA interactions

Number of interactions: 103

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000075120 solute carrier family 2 (facilitated glucose transporter), member 3 protein coding ENST00000604716 525 293 UTR3 Trans
ENST00000227155 CD82 molecule protein coding ENST00000604716 642 298 UTR3 Trans
ENST00000242057 aryl hydrocarbon receptor protein coding ENST00000604716 545 302 UTR3 Trans
ENST00000327473 tumor necrosis factor, alpha-induced protein 8-like 1 protein coding ENST00000604716 651 301 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000604716 607 279 UTR3 Trans
ENST00000381639 retinitis pigmentosa 9 pseudogene processed transcript ENST00000604716 511 296 noncoding Trans
ENST00000382142 myotubularin related protein 12 protein coding ENST00000604716 563 288 UTR3 Trans
ENST00000409458 glycoprotein (transmembrane) nmb protein coding ENST00000604716 606 273 UTR3 Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000604716 597 287 UTR5 Trans
ENST00000442007 antisense antisense ENST00000604716 608 291 noncoding Trans
ENST00000463496 aryl hydrocarbon receptor nonsense mediated decay ENST00000604716 545 302 UTR3 Trans
ENST00000482603 glyoxylate reductase/hydroxypyruvate reductase processed transcript ENST00000604716 595 294 noncoding Trans
ENST00000482603 glyoxylate reductase/hydroxypyruvate reductase processed transcript ENST00000604716 622 274 noncoding Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000604716 570 286 noncoding Trans
ENST00000552918 spermatogenesis associated, serine-rich 2 protein coding ENST00000604716 599 283 UTR3 Trans
ENST00000552918 spermatogenesis associated, serine-rich 2 protein coding ENST00000604716 641 279 UTR3 Trans
ENST00000553127 spermatogenesis associated, serine-rich 2 protein coding ENST00000604716 603 285 UTR3 Trans
ENST00000553127 spermatogenesis associated, serine-rich 2 protein coding ENST00000604716 665 295 UTR3 Trans
ENST00000569832 SSTR5 antisense RNA 1 lincRNA ENST00000604716 531 285 noncoding Trans
ENST00000620139 melanoregulin protein coding ENST00000604716 642 296 UTR3 Trans
TCONS_00001821 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000604716 616 283 UTR5 Trans
TCONS_00001823 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000604716 616 283 UTR5 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000604716 635 290 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000604716 631 287 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000604716 622 289 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000604716 608 299 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000604716 601 290 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000604716 622 289 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000604716 642 298 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000604716 642 298 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000604716 625 286 UTR5 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000604716 603 285 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000604716 665 295 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000604716 549 238 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000604716 639 295 UTR3 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000604716 649 284 UTR5 Trans
TCONS_00075840 forkhead box N3 novel protein coding ENST00000604716 624 301 UTR3 Trans
TCONS_00075841 forkhead box N3 novel protein coding ENST00000604716 624 301 UTR3 Trans
TCONS_00088780 synaptotagmin XVII novel protein coding ENST00000604716 616 294 UTR3 Trans
TCONS_00095053 epithelial membrane protein 2 novel protein coding ENST00000604716 556 271 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000604716 616 292 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000604716 616 292 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000604716 616 292 UTR3 Trans
TCONS_00101169 myosin phosphatase Rho interacting protein novel protein coding ENST00000604716 590 297 UTR3 Trans
TCONS_00101169 myosin phosphatase Rho interacting protein novel protein coding ENST00000604716 600 294 UTR3 Trans
TCONS_00109814 lincRNA novel protein coding ENST00000604716 519 292 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000604716 525 280 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000604716 649 298 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000604716 627 296 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000604716 644 284 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000604716 633 263 UTR5 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding ENST00000604716 617 280 UTR5 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000604716 602 290 UTR3 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000604716 600 276 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000604716 602 290 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000604716 600 276 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000604716 600 283 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000604716 600 283 UTR5 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding ENST00000604716 612 290 UTR3 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding ENST00000604716 601 309 UTR3 Trans
TCONS_00149280 Uncharacterized protein {ECO:0000313|Ensembl:ENSP00000416453} novel protein coding ENST00000604716 630 300 UTR3 Trans
TCONS_00160920 protein tyrosine kinase 6 novel protein coding ENST00000604716 634 307 UTR5 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000604716 631 295 UTR3 Trans
TCONS_00165715 LIM domain kinase 2 novel protein coding ENST00000604716 549 288 UTR3 Trans
TCONS_00165715 LIM domain kinase 2 novel protein coding ENST00000604716 540 291 UTR3 Trans
TCONS_00165721 LIM domain kinase 2 novel protein coding ENST00000604716 549 288 UTR3 Trans
TCONS_00165721 LIM domain kinase 2 novel protein coding ENST00000604716 540 291 UTR3 Trans
TCONS_00166381 GRB2-related adaptor protein 2 novel protein coding ENST00000604716 662 299 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000604716 622 294 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000604716 627 291 UTR3 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000604716 628 303 UTR5 Trans
TCONS_00192159 amyloid beta (A4) precursor protein-binding, family B, member 2 novel protein coding ENST00000604716 524 229 UTR3 Trans
TCONS_00192322 tec protein tyrosine kinase novel protein coding ENST00000604716 615 296 UTR5 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000604716 629 298 UTR5 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000604716 634 273 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000604716 629 298 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000604716 634 273 UTR5 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000604716 606 286 UTR5 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000604716 601 290 UTR3 Trans
TCONS_00200504 Rho GTPase activating protein 26 novel protein coding ENST00000604716 609 290 UTR3 Trans
TCONS_00200901 GM2 ganglioside activator novel protein coding ENST00000604716 611 285 UTR3 Trans
TCONS_00200902 GM2 ganglioside activator novel protein coding ENST00000604716 611 285 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000604716 622 285 UTR3 Trans
TCONS_00204896 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000604716 612 285 UTR5 Trans
TCONS_00204911 erythrocyte membrane protein band 4.1 like 4A novel noncoding ENST00000604716 632 292 noncoding Trans
TCONS_00210928 leucine rich repeat containing 1 novel protein coding ENST00000604716 607 298 UTR3 Trans
TCONS_00211226 antisense novel protein coding ENST00000604716 615 283 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000604716 635 293 UTR5 Trans
TCONS_00220258 aryl hydrocarbon receptor novel protein coding ENST00000604716 545 302 UTR3 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000604716 606 287 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000604716 606 287 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000604716 606 287 UTR3 Trans
TCONS_00240045 zinc finger protein 706 novel protein coding ENST00000604716 635 300 UTR3 Trans
TCONS_00240046 zinc finger protein 706 novel protein coding ENST00000604716 635 300 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000604716 611 283 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000604716 628 290 UTR5 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000604716 618 287 UTR5 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000604716 622 287 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000604716 618 287 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000604716 622 287 UTR5 Trans
TCONS_00245543 long intergenic non-protein coding RNA 963 novel protein coding ENST00000604716 620 296 UTR3 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000604716 621 279 UTR3 Trans
TCONS_00251977 G protein-coupled receptor 82 novel protein coding ENST00000604716 578 283 UTR3 Trans

Sequence

>TCONS_00251977 (1944 nt)
TATTATTATTATTATTTTGTATTTTCTGCAGAAATGGGGTTTGGTCATGTTACCCAGGCTGGTCTCAAGCTCCTGGGATCAAGTGATCCGTCCGCCTTTG
CCTCCCAAAGTGCTGGGATTACAGCGGGGAGCCACTGCGCCCAGCCCAGCCAGCCCGATTCTGACCCAGAGGGTTTAGAAGTTGCTTAGACAGATCTGCT
CCTGTAAGTTCACAGAACTCCTCTGGCTACTGCTGTCCCTTTTTTTCCTGAGTCTTGTTTGCTGAAATCTTCTTGAGATTCTGTGAGACAATAGCCCCTA
TTTCTTCCAGTAAATTACTCTTTTTCTTCCCCTTTAGACAGCCAGTGCTGGTTTCTGTTACATGTAAACAAAAAGGATTTTATTTTTTATTTTTTTAGGC
TAGTCAAGTGAAGCAGTGGGAGGCGGAGGACAAAAAGAATTTTGACTAAGGCAATAAATATATTATACAAGTGAAGTATTTCCCAAACTGTATTCTGTGG
AATGCTGTGTTCTCAAATGTTAACAAGTTCCATACAAGAACCATTTATTTCTAAATTCTAAAGTCACATTCATATTATGAATTATATTAAACATATATAG
TTACTTTTATTATACCTAATAATCTGTCTTTATAAAAGTGTTTACCCAAAAATGCCAGCAGATTCCATGAGAAACTACCTGTACTACAATGATCGTCAAA
CTTTGGTGCATACATGACAGAATCAACCGGAGGGCTTGTTAAAGGATTGCTGAGTCAAACCCCTCGTTTCAGCAGGTTTGTGGTGGGGCCTGAGAATTTA
CATTTCTTTTTTTTTTTTTTTTAGACGGAGTCTTGCTCTGTTGCCCAGACTGGAGTGCAGTGGTGCGATCTTGGCTCACTGCAACCTCCGCCTCCCGGTT
CAAGCGATTCTTCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGTGCCCGCCACCATGCTCAGCTAATTTTTGGATTTTTAGTAGAGACGGGGTTTTA
CCATATTGGCCAGGCTGGTCTCGAACTCCTGACCTTGTGACCCACCCACCTCGGCCTCCCAAATTGCTGGGATTACAGGCAAGAGCCACCGCGCCCTGCC
GAGAATTTGCATTTCTAACAAGTTCCCAGGTGATGCTGACACTGCTGGCTCATGGAACCACTGCTGTAGTATTTTCCAAATTATCCTGATTCTAAGAACC
ACCTATGACCTGTGCTGTTTTTTCAGTGGTTACTGGCTCATGTCACATAAATTCTTTTAGGATTCAAACATGTTTGTGATATTACTCAGTATTTACATCT
TGCTTTTACTGCAGCATGATAGAAAAATTAACCACAGGTATATCATAACAAAAAGACCATGAGTTACCATTTTCACAAAGTTCAGATATATTTAAATTAG
CCTATTTAATCTTTTTTTGGTTGTTGTTGAGATGGAGTCTCACTCTGTCTCTCAGGCTGGAGTACAGTGGCACAATCTCAGCTCACTGCAACCTCTGCCT
CCCAGGTTCAAGTAATTCTCCTGCCTCAGCCTCCCGAGTAGCGGGGATTACAGGTGCCCAACACCACACATGGCTAATTTTTGTATTTTTAGTAGAGATG
GGGTTTTGCCATGTTAGCCAGGCTGGTCTTGAACTCCTGACCTCAGATGATCCGCCTGCCTCGGCCTCTCAAAGTGCTGGGATTACAGGCATGAGCCATC
GCACCCAGCCTATGGTACACCTTTACTGAGGAAACAATTCAGGAACATCACTCTTAGTAAGGCAATTGTTGATTATAAGTCAAAAAAACACCATCATGTA
CAAATTCAGGGGATTTTGTATACCTTGTTTTTTTGGTTACAAATATGCAAAATTAAAGATGTTTGCTAATACTTGTTTCCAATTTTTAAACTTTTCAAGT
GTTGCACTGTTAATAATGTTAAAATAAAAGGCATTTGACTTAGTA

Expression



Full and truncated open reading frames discovered in TCONS_00251977

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.