Detailed information on ENST00000609706

lncRNA-RNA interactions

Number of interactions: 64

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000609706 523 299 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000609706 543 266 noncoding Trans
ENST00000399120 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000609706 605 307 UTR5 Trans
ENST00000427746 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000609706 605 307 UTR5 Trans
ENST00000432564 hydroxycarboxylic acid receptor 1 protein coding ENST00000609706 607 292 UTR3 Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000609706 523 299 UTR3 Trans
ENST00000450928 antisense antisense ENST00000609706 561 306 noncoding Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000609706 564 302 CDS Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000609706 528 294 CDS Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000609706 557 302 noncoding Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000609706 639 268 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000609706 604 293 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000609706 637 300 UTR3 Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000609706 563 296 UTR3 Trans
ENST00000604000 Lix1 homolog (chicken) like protein coding ENST00000609706 550 297 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000609706 566 307 UTR3 Trans
TCONS_00006772 lincRNA novel protein coding ENST00000609706 610 310 UTR3 Trans
TCONS_00007944 kin of IRRE like (Drosophila) novel protein coding ENST00000609706 542 310 UTR3 Trans
TCONS_00014134 collagen, type XVI, alpha 1 novel protein coding ENST00000609706 600 301 UTR3 Trans
TCONS_00025758 zinc finger, MIZ-type containing 1 novel protein coding ENST00000609706 641 306 UTR5 Trans
TCONS_00025760 zinc finger, MIZ-type containing 1 novel protein coding ENST00000609706 641 306 UTR5 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000609706 641 306 UTR5 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000609706 600 290 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000609706 600 290 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000609706 654 284 UTR3 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000609706 604 293 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000609706 604 293 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000609706 604 293 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000609706 604 293 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000609706 604 293 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000609706 604 293 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000609706 604 293 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000609706 604 293 UTR3 Trans
TCONS_00061864 transmembrane protein 116 novel protein coding ENST00000609706 611 303 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000609706 610 303 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000609706 610 303 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000609706 610 303 UTR5 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000609706 672 315 UTR3 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000609706 605 300 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000609706 605 300 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000609706 503 298 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000609706 600 311 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000609706 600 311 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000609706 637 300 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000609706 614 276 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000609706 614 276 UTR3 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000609706 511 301 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000609706 541 301 UTR5 Trans
TCONS_00118358 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000609706 601 294 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000609706 643 306 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000609706 611 305 UTR5 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000609706 589 300 UTR5 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000609706 616 273 UTR5 Trans
TCONS_00150627 UDP-glucuronate decarboxylase 1 novel protein coding ENST00000609706 636 301 UTR5 Trans
TCONS_00161618 interferon gamma receptor 2 (interferon gamma transducer 1) novel protein coding ENST00000609706 568 297 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000609706 622 269 noncoding Trans
TCONS_00215909 O-acyl-ADP-ribose deacylase 1 novel protein coding ENST00000609706 588 301 UTR3 Trans
TCONS_00221037 POU class 6 homeobox 2 novel noncoding ENST00000609706 632 330 noncoding Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000609706 602 295 UTR3 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000609706 640 305 UTR5 Trans
TCONS_00238831 cytochrome P450, family 7, subfamily B, polypeptide 1 novel protein coding ENST00000609706 515 293 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000609706 623 300 CDS_UTR Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000609706 633 320 UTR3 Trans
TCONS_00246881 cyclin-dependent kinase inhibitor 2A novel protein coding ENST00000609706 626 299 UTR5 Trans

Sequence

>TCONS_00246881 (1139 nt)
GAGACAGCCATATCCAGAAGGAAGAGGAGCCGCGTTCCGTGGCTCACACCTGTAACCCCACCAGTTTGGGAGGCCGAGGCGGGCGGATCACCTGAGGCTG
AGGCCGGGGGTTTGAGACCAGCCTGACCAATATGGAGAAACCCCGTCTCTACTAAAAATACAAAATTAGCCGGGAGTGGTGGCGCATGCCTGTAATTCCA
GCTACTCGGGAGGCTGAGGCAGGAGAGTCGCTTGAACCCGGGAGGCGGAGGTTGCGGTGAGCCGAGATCGCGCCATTGCACTCTAGCCTGGGCAACAAGA
GGGAAAACTCCGTCTAAAAAGAATAAGAGGGTTACAAGTAGCCTGAATTTTCCTCTCTTCAAATAGGGACTTCTCAAAGAAGGTGAATCTATAATAGTGG
TGTAGATTCAGATATAAGGACACGTATTTGGCGTAAAGGAGAGGCAAAGTTAGAGGAACCAGAAAGAATGCTACACAAAAGATGGCCGGCTTCTCGCGTG
AAGGAAGATTCGGATACGGGGGCCTGATGGATTTAGTTGTAGGCGGTTTGCCTGCAGCGAGTAAATTATTCAAACGTTCGGACTTCACAAGACTAAACTT
ACTGGGGATAAAAATTGAGATTTGGCCGGGCGCGATGGCTCACGCCTGTAATCCCTACACTTTGGGAGGCCGAGGCGGGTGGATGATCTGAGATCAGGAG
TTCGAGACCAGCCTGGCCGAAATGGCGAAACCCCGTCTCTATTAAAAATACAAAAATTAGCCGGGAGTGGTAGCGTCCGCCTGTAATCCCAGCTACTCAG
GAGGCTGAAGCAGGAGAATCGGTGGAACCTGAGAGGCAGAGGCTGTAGTGAGCCGAGATCGCGCCACTGCACTCCAGCCTGGGCGACAGAGCAAGACTCC
GTCTAAAAAAAAAAAGAAAAAAAAAAATTGAGATTTGGTCCCATGCAGTAAGAGGGAATGGAGAACAGGAGCCACCCAACTTTGGACATTAAAGTTGGAG
CAGGCAAAGATGAGGCCAGCTGTGTCGCGAAGCCTGGGACATGGGCAGCTCTTGAGTACACCGGGTTCGAGGCCAGGGGAAACCCTCAAGGTAGAGATGG
GGTTATAAAGCAAACCAATAAAAACCGGTGTATGAGTCAA

Expression



Full and truncated open reading frames discovered in TCONS_00246881

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.