Detailed information on ENST00000610279

lncRNA-RNA interactions

Number of interactions: 176

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000261653 syntaxin 2 protein coding ENST00000610279 558 298 UTR3 Trans
ENST00000263026 eukaryotic elongation factor-2 kinase protein coding ENST00000610279 615 287 UTR3 Trans
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000610279 661 297 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000610279 636 302 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000610279 628 305 UTR3 Trans
ENST00000368324 synaptotagmin XI protein coding ENST00000610279 616 291 UTR3 Trans
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000610279 644 307 UTR3 Trans
ENST00000392373 syntaxin 2 protein coding ENST00000610279 558 298 UTR3 Trans
ENST00000394622 STEAP family member 2, metalloreductase protein coding ENST00000610279 691 305 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000610279 623 279 noncoding Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000610279 644 307 UTR3 Trans
ENST00000463954 SET domain containing 6 retained intron ENST00000610279 641 284 noncoding Trans
ENST00000470361 potassium large conductance calcium-activated channel, subfamily M, beta member 2 processed transcript ENST00000610279 568 301 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000610279 610 305 CDS_UTR Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000610279 502 307 UTR3 Trans
ENST00000517408 antisense antisense ENST00000610279 601 301 noncoding Trans
ENST00000521027 pleckstrin and Sec7 domain containing 3 protein coding ENST00000610279 571 301 CDS_UTR Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000610279 594 302 noncoding Trans
ENST00000536180 vacuole membrane protein 1 protein coding ENST00000610279 528 234 CDS Trans
ENST00000547804 long intergenic non-protein coding RNA 941 lincRNA ENST00000610279 623 295 noncoding Trans
ENST00000569455 cadherin 13 processed transcript ENST00000610279 679 309 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000610279 656 302 UTR3 Trans
ENST00000579685 adenomatosis polyposis coli down-regulated 1 nonsense mediated decay ENST00000610279 596 292 CDS Trans
ENST00000620139 melanoregulin protein coding ENST00000610279 660 301 UTR3 Trans
TCONS_00001594 lincRNA novel protein coding ENST00000610279 692 293 UTR5 Trans
TCONS_00006081 processed_pseudogene novel protein coding ENST00000610279 685 304 UTR5 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding ENST00000610279 644 280 UTR3 Trans
TCONS_00011358 5-methyltetrahydrofolate-homocysteine methyltransferase novel protein coding ENST00000610279 655 289 UTR5 Trans
TCONS_00011359 5-methyltetrahydrofolate-homocysteine methyltransferase novel protein coding ENST00000610279 655 289 UTR5 Trans
TCONS_00025758 zinc finger, MIZ-type containing 1 novel protein coding ENST00000610279 635 304 UTR5 Trans
TCONS_00025760 zinc finger, MIZ-type containing 1 novel protein coding ENST00000610279 635 304 UTR5 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000610279 635 304 UTR5 Trans
TCONS_00025805 zinc finger, MIZ-type containing 1 novel protein coding ENST00000610279 680 302 UTR3 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000610279 653 289 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000610279 653 289 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000610279 639 273 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000610279 703 291 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000610279 631 304 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000610279 662 286 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000610279 662 286 UTR3 Trans
TCONS_00038233 protease, serine, 23 novel protein coding ENST00000610279 684 289 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000610279 619 286 UTR5 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000610279 631 301 UTR3 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000610279 631 301 UTR3 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000610279 604 302 UTR5 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000610279 560 284 UTR3 Trans
TCONS_00050077 long intergenic non-protein coding RNA 941 novel protein coding ENST00000610279 623 295 UTR5 Trans
TCONS_00050195 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000610279 615 301 UTR5 Trans
TCONS_00056597 C-type lectin domain family 7, member A novel protein coding ENST00000610279 674 308 UTR3 Trans
TCONS_00061864 transmembrane protein 116 novel protein coding ENST00000610279 608 295 UTR3 Trans
TCONS_00061864 transmembrane protein 116 novel protein coding ENST00000610279 630 294 UTR3 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000610279 602 292 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000610279 602 292 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000610279 602 292 UTR5 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000610279 665 301 UTR3 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000610279 610 293 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000610279 674 309 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000610279 666 302 UTR5 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000610279 673 302 UTR5 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000610279 724 305 UTR3 Trans
TCONS_00089062 eukaryotic elongation factor-2 kinase novel protein coding ENST00000610279 615 287 UTR3 Trans
TCONS_00089065 eukaryotic elongation factor-2 kinase novel protein coding ENST00000610279 615 287 UTR3 Trans
TCONS_00089066 eukaryotic elongation factor-2 kinase novel protein coding ENST00000610279 615 287 UTR3 Trans
TCONS_00090939 nucleoporin 93kDa novel protein coding ENST00000610279 601 301 UTR5 Trans
TCONS_00098745 transmembrane protein 170A novel protein coding ENST00000610279 611 294 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000610279 663 303 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000610279 663 303 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000610279 612 292 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000610279 656 302 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000610279 664 279 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000610279 664 279 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 690 291 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 707 305 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 682 301 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 707 305 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 682 301 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 690 291 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 649 286 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 556 286 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 707 305 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 682 301 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 694 303 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 707 305 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 682 301 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 690 291 UTR3 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 707 305 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 682 301 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 690 291 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 690 291 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 707 305 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 682 301 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 690 291 UTR3 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 707 305 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000610279 682 301 UTR5 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding ENST00000610279 676 304 UTR3 Trans
TCONS_00116334 low density lipoprotein receptor class A domain containing 4 novel protein coding ENST00000610279 639 303 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000610279 652 295 UTR3 Trans
TCONS_00119477 zinc finger and BTB domain containing 7C novel protein coding ENST00000610279 612 280 UTR5 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000610279 687 306 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000610279 722 301 UTR5 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000610279 636 301 UTR5 Trans
TCONS_00140000 long intergenic non-protein coding RNA 152 novel protein coding ENST00000610279 614 297 UTR3 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000610279 729 287 UTR5 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000610279 666 307 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000610279 631 305 UTR5 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000610279 666 307 UTR3 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000610279 631 305 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000610279 666 307 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000610279 631 305 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000610279 666 307 UTR3 Trans
TCONS_00141681 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000610279 666 307 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000610279 662 303 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000610279 619 289 UTR3 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding ENST00000610279 680 288 UTR3 Trans
TCONS_00150689 ectodysplasin A receptor novel protein coding ENST00000610279 694 303 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000610279 661 297 UTR3 Trans
TCONS_00163084 T-cell lymphoma invasion and metastasis 1 novel protein coding ENST00000610279 663 303 UTR5 Trans
TCONS_00163348 runt-related transcription factor 1 novel protein coding ENST00000610279 706 296 UTR3 Trans
TCONS_00163350 runt-related transcription factor 1 novel protein coding ENST00000610279 706 296 UTR3 Trans
TCONS_00163352 runt-related transcription factor 1 novel protein coding ENST00000610279 706 296 UTR3 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000610279 645 299 UTR5 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000610279 674 302 UTR5 Trans
TCONS_00168418 dual specificity phosphatase 18 novel protein coding ENST00000610279 697 289 UTR5 Trans
TCONS_00173724 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000610279 735 302 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000610279 735 302 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000610279 642 301 UTR5 Trans
TCONS_00173730 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000610279 735 302 UTR5 Trans
TCONS_00175515 transient receptor potential cation channel, subfamily C, member 1 novel protein coding ENST00000610279 717 303 UTR5 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000610279 666 301 UTR3 Trans
TCONS_00185516 transcribed_unprocessed_pseudogene novel protein coding ENST00000610279 692 305 UTR3 Trans
TCONS_00185519 transcribed_unprocessed_pseudogene novel protein coding ENST00000610279 692 305 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000610279 679 302 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000610279 673 288 UTR3 Trans
TCONS_00187460 spermatogenesis associated 18 novel protein coding ENST00000610279 689 287 UTR3 Trans
TCONS_00189916 doublecortin-like kinase 2 novel protein coding ENST00000610279 632 310 UTR3 Trans
TCONS_00189917 doublecortin-like kinase 2 novel protein coding ENST00000610279 632 310 UTR3 Trans
TCONS_00189925 doublecortin-like kinase 2 novel protein coding ENST00000610279 632 310 UTR3 Trans
TCONS_00190276 transmembrane protein 144 novel protein coding ENST00000610279 649 293 UTR3 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000610279 655 303 UTR5 Trans
TCONS_00192322 tec protein tyrosine kinase novel protein coding ENST00000610279 636 289 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000610279 656 295 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000610279 610 305 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000610279 610 305 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000610279 662 302 UTR5 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000610279 658 301 UTR5 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000610279 645 277 UTR5 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000610279 684 308 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000610279 500 299 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000610279 630 319 UTR5 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000610279 656 289 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000610279 656 289 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000610279 630 319 UTR5 Trans
TCONS_00203988 family with sequence similarity 169, member A novel noncoding ENST00000610279 630 319 noncoding Trans
TCONS_00203988 family with sequence similarity 169, member A novel noncoding ENST00000610279 656 289 noncoding Trans
TCONS_00204896 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000610279 616 303 UTR5 Trans
TCONS_00210928 leucine rich repeat containing 1 novel protein coding ENST00000610279 615 248 UTR3 Trans
TCONS_00210939 leucine rich repeat containing 1 novel protein coding ENST00000610279 615 248 UTR5 Trans
TCONS_00212185 TEC novel protein coding ENST00000610279 604 311 UTR3 Trans
TCONS_00213775 LYR motif containing 4 novel noncoding ENST00000610279 653 296 noncoding Trans
TCONS_00219475 WD repeat domain 27 novel protein coding ENST00000610279 615 300 UTR3 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000610279 684 304 UTR5 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000610279 647 301 UTR5 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding ENST00000610279 663 290 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000610279 620 306 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000610279 734 298 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000610279 733 305 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000610279 631 302 CDS_UTR Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000610279 742 294 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000610279 742 294 UTR5 Trans
TCONS_00243489 proprotein convertase subtilisin/kexin type 5 novel protein coding ENST00000610279 622 266 UTR3 Trans
TCONS_00245543 long intergenic non-protein coding RNA 963 novel protein coding ENST00000610279 650 270 UTR3 Trans
TCONS_00246881 cyclin-dependent kinase inhibitor 2A novel protein coding ENST00000610279 650 300 UTR5 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000610279 636 302 UTR3 Trans
TCONS_00251973 G protein-coupled receptor 34 novel protein coding ENST00000610279 639 310 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000610279 604 255 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000610279 766 299 UTR5 Trans

Sequence

>TCONS_00252827 (1221 nt)
ATACTCAGGGACACCGTCCCCCCCTCCGCCCCCCGCCCTCCGTAAGTGCTATTTTTACATCGAATGCCCTAGTCTGGAAGTAGGTAAACTGAAACTAAGC
TCAAATCAAAAGGAGAAAGGCTGGAAAACAAGAGGCTACAAGCTCCAGAAGCTCCGAGCGAGGATGAAAATTAGCCAGCCCACAGGTGGGCTCTGCGCGG
CCCTGAAAGTCGCACTCTGACCTGACCCTTTCCGCCTCTCGTTTTTCCTTCCAGCCTCGCTTCAAAGTTCTGTATTGCAGAATGAAATCGGCGCCTTTCC
CCAGCGGTTTTTCCAAATACGAGCAAAGGAGGCACAAAACGCAGGTTCCAGAAACTGTGCCTGCAACCATTCGTCCTTATTTCCCGACACACGGGCCCCT
GCTCCCCGCTAAGGCTGGGGTCCTGGACACGAGTTTTGCGCTCTGATAGAAGGGCTTAGATTCCAGATTGACACTGGGCTCTCTAAAGCCTGCTCCTCAA
TCTACTGATCCGGTCCAGCTTAAGATCCAGTAGAAAGAAAACATAGCCTGCCCGGACCGTAACCTTTTTGTTTCAGACCCTGCATTTGTAAAATAGCCTA
ATAAAATCTCTCCCTGGCTTACAGAGCAAGACAGCGTCCTGGTCCAAGAACCGGATGAGTCAAAAGGCGTTACTGTTGAGTCAGACATAGAATACATGAA
TACCTAGAAATTCGTAAATGATTCTCCAAAGGCTGTTGAAATAGCGTTTTCAGGCCGGGCGCGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCC
GAGGCGGGCGGATCACCTGAGGTCAGGAGATGGAGACCATCCTGGCTAACACGGTGAAACCTCGTCTCTACTGAAAATACAAAAAATTAGCCGGGCGTGG
TGGCGGGGGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAAAATCGCTTGAACCCGGGAGGCGGAGCTTGCAGTGAGCCGGGATCGCACCACTGC
CCTCCAGCCTGGGCGACAGAGCAAGACTCTGTCTCAAAAAATGAAAAAAGAAATAGCGTTTTCAAGTTATAATCAGGTGCGATGATGAATGCTATTAATG
CCATTTTTAAGAATAGTAAGTGCAGGATGTTGATAGGTTATTCTGGGAGGAAGGGAGATGGGGTATGTGAACTCTGTACTTTCCCCTCAATTTTGCTGTG
AAACTAAACTGCTCTAAAAGTA

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.