| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000263955 | serine/threonine kinase 17b | protein coding | ENST00000612598 | 601 | 297 | UTR3 | Trans | |
| ENST00000336824 | fibronectin type III domain containing 3B | protein coding | ENST00000612598 | 549 | 296 | UTR3 | Trans | |
| ENST00000375120 | OTU deubiquitinase 3 | protein coding | ENST00000612598 | 640 | 302 | UTR3 | Trans | |
| ENST00000399120 | holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) | protein coding | ENST00000612598 | 560 | 300 | UTR5 | Trans | |
| ENST00000427746 | holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) | protein coding | ENST00000612598 | 560 | 300 | UTR5 | Trans | |
| ENST00000448612 | WD repeat domain 27 | protein coding | ENST00000612598 | 528 | 304 | CDS | Trans | |
| ENST00000450928 | antisense | antisense | ENST00000612598 | 502 | 304 | noncoding | Trans | |
| ENST00000511184 | E74-like factor 2 (ets domain transcription factor) | nonsense mediated decay | ENST00000612598 | 591 | 306 | CDS_UTR | Trans | |
| ENST00000517408 | antisense | antisense | ENST00000612598 | 552 | 301 | noncoding | Trans | |
| TCONS_00075813 | forkhead box N3 | novel protein coding | ENST00000612598 | 617 | 299 | UTR5 | Trans | |
| TCONS_00075827 | forkhead box N3 | novel protein coding | ENST00000612598 | 617 | 299 | UTR3 | Trans | |
| TCONS_00107864 | transient receptor potential cation channel, subfamily V, member 1 | novel protein coding | ENST00000612598 | 605 | 296 | UTR3 | Trans | |
| TCONS_00107867 | transient receptor potential cation channel, subfamily V, member 1 | novel protein coding | ENST00000612598 | 605 | 296 | UTR3 | Trans | |
| TCONS_00109011 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000612598 | 557 | 299 | UTR5 | Trans | |
| TCONS_00109011 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000612598 | 577 | 303 | UTR5 | Trans | |
| TCONS_00153158 | serine/threonine kinase 17b | novel protein coding | ENST00000612598 | 601 | 297 | UTR3 | Trans | |
| TCONS_00161618 | interferon gamma receptor 2 (interferon gamma transducer 1) | novel protein coding | ENST00000612598 | 565 | 295 | UTR3 | Trans | |
| TCONS_00170642 | solute carrier family 6 (neurotransmitter transporter), member 6 | novel protein coding | ENST00000612598 | 546 | 298 | UTR3 | Trans | |
| TCONS_00173891 | RNA, U6 small nuclear 461, pseudogene | novel protein coding | ENST00000612598 | 598 | 288 | UTR3 | Trans | |
| TCONS_00189916 | doublecortin-like kinase 2 | novel protein coding | ENST00000612598 | 512 | 300 | UTR3 | Trans | |
| TCONS_00189917 | doublecortin-like kinase 2 | novel protein coding | ENST00000612598 | 512 | 300 | UTR3 | Trans | |
| TCONS_00189925 | doublecortin-like kinase 2 | novel protein coding | ENST00000612598 | 512 | 300 | UTR3 | Trans | |
| TCONS_00219475 | WD repeat domain 27 | novel protein coding | ENST00000612598 | 528 | 304 | UTR3 | Trans | |
| TCONS_00225245 | family with sequence similarity 115, member C | novel protein coding | ENST00000612598 | 553 | 299 | UTR3 | Trans | |
| TCONS_00225248 | family with sequence similarity 115, member C | novel protein coding | ENST00000612598 | 553 | 299 | UTR3 | Trans | |
| TCONS_00251973 | G protein-coupled receptor 34 | novel protein coding | ENST00000612598 | 543 | 289 | UTR3 | Trans |
>TCONS_00251973 (912 nt)
ACAGGGGCGTGCGTGAGTTCCGGCGGCCTGCACCGGGCAAACCCCGTACCTTCCCAGCATCGGCTCAGCAACCCACGTGCATCCAGGCCGGTCAATGTCA
TTGAGTCACCTCCGCGCCTTGGCCACCCTGGAGTCCCGAGAATCCGAAGTTCCAGACAAATGCCCAAACTACATTCCTGCATGTTCGAAAGCGTAAATTG
CAAAGCACAAATCCAGTTGTAGATTGTGGCCGGGAGCAGTGGCTCACGCCTATAATCCCAGCACTTTGGGAGGCCGAGGCGGACAGATCACGAGGTCAGC
ACTTCGAGACCAGCATGGCCAACATGGTGAAGCCCCATCTCTACTAAAAATACAAACATTAGCCAGGCATGGTGGTAGGCCCCTGTAATCCCAGCTACTC
GGTAGGCTGAGGCAGGAGAATCACTTGAACCCGGGAGGCAGAGGTTTCAGTGAGCTGAGACTGCACCATTGCACTCCAGCCTGGGCGACAGACCAAGACT
CCATCTCAAAAAAAAAAAAAAAAAAGTTATAGATTGTAAGGAAAATACCCCCAAGGAAGTTGAGGACACAGCAGACTTGGACTGTCTCCAAACCTGTTCA
TTCTTCTGAGTGCACTGCTCGGAGCATCCTATTGGGCAGCATATCCTGGCCTCCTTTCCAGTTCGATGTGGTACTATACCTGATTTCTGGCCAATAAAAT
ATGAGAGGACATGAAATTCAACAGCCCCTGGGCTTGGCTTATAAAACCTTCCATGCAATCCTCCACACCTTTTCACCTCTCAGCTGCTGAGACTTTTCTA
GGCACTACACAGAAGCAGCCTGGGTCTCCAGTAGCAAAGGAGAGCAGATCCTTCTCACTATCCTGCACCGAACTGTGACATGAGCAAAAAATAAAGTTTT
TATTTTCTTACAC
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.