| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000389534 | zinc finger protein 841 | protein coding | ENST00000612986 | 538 | 268 | UTR3 | Trans | |
| ENST00000426391 | zinc finger protein 841 | protein coding | ENST00000612986 | 538 | 268 | UTR3 | Trans | |
| ENST00000439138 | transmembrane protein 98 | protein coding | ENST00000612986 | 524 | 292 | UTR5 | Trans | |
| ENST00000513143 | podoplanin | protein coding | ENST00000612986 | 558 | 301 | UTR5 | Trans | |
| ENST00000553127 | spermatogenesis associated, serine-rich 2 | protein coding | ENST00000612986 | 609 | 294 | UTR3 | Trans | |
| ENST00000560870 | sense_intronic | sense intronic | ENST00000612986 | 538 | 265 | noncoding | Trans | |
| ENST00000594295 | zinc finger protein 841 | protein coding | ENST00000612986 | 538 | 268 | UTR3 | Trans | |
| ENST00000620139 | melanoregulin | protein coding | ENST00000612986 | 642 | 307 | UTR3 | Trans | |
| TCONS_00030130 | calcium/calmodulin-dependent protein kinase II gamma | novel protein coding | ENST00000612986 | 640 | 305 | UTR3 | Trans | |
| TCONS_00050741 | spermatogenesis associated, serine-rich 2 | novel protein coding | ENST00000612986 | 609 | 294 | UTR3 | Trans | |
| TCONS_00065093 | UBA domain containing 2 | novel protein coding | ENST00000612986 | 622 | 297 | UTR5 | Trans | |
| TCONS_00065094 | UBA domain containing 2 | novel protein coding | ENST00000612986 | 622 | 297 | UTR5 | Trans | |
| TCONS_00066624 | calcium binding protein 39-like | novel protein coding | ENST00000612986 | 517 | 260 | UTR3 | Trans | |
| TCONS_00090929 | nucleoporin 93kDa | novel protein coding | ENST00000612986 | 622 | 298 | UTR3 | Trans | |
| TCONS_00101169 | myosin phosphatase Rho interacting protein | novel protein coding | ENST00000612986 | 547 | 292 | UTR3 | Trans | |
| TCONS_00107864 | transient receptor potential cation channel, subfamily V, member 1 | novel protein coding | ENST00000612986 | 620 | 297 | UTR3 | Trans | |
| TCONS_00107867 | transient receptor potential cation channel, subfamily V, member 1 | novel protein coding | ENST00000612986 | 620 | 297 | UTR3 | Trans | |
| TCONS_00123889 | ribosomal protein SA pseudogene 58 | novel protein coding | ENST00000612986 | 525 | 284 | UTR3 | Trans | |
| TCONS_00123899 | ribosomal protein SA pseudogene 58 | novel protein coding | ENST00000612986 | 525 | 284 | UTR3 | Trans | |
| TCONS_00124891 | zinc finger protein 540 | novel protein coding | ENST00000612986 | 614 | 260 | UTR5 | Trans | |
| TCONS_00135644 | zinc finger protein 841 | novel protein coding | ENST00000612986 | 538 | 268 | UTR3 | Trans | |
| TCONS_00161482 | BTB and CNC homology 1, basic leucine zipper transcription factor 1 | novel protein coding | ENST00000612986 | 614 | 336 | UTR3 | Trans | |
| TCONS_00166381 | GRB2-related adaptor protein 2 | novel protein coding | ENST00000612986 | 664 | 311 | UTR3 | Trans | |
| TCONS_00186316 | KIAA0232 | novel protein coding | ENST00000612986 | 608 | 297 | UTR5 | Trans | |
| TCONS_00190799 | sorting nexin 25 | novel protein coding | ENST00000612986 | 604 | 290 | UTR3 | Trans | |
| TCONS_00190999 | zinc finger protein 721 | novel protein coding | ENST00000612986 | 601 | 298 | UTR3 | Trans | |
| TCONS_00192322 | tec protein tyrosine kinase | novel protein coding | ENST00000612986 | 649 | 308 | UTR5 | Trans | |
| TCONS_00192331 | tec protein tyrosine kinase | novel protein coding | ENST00000612986 | 513 | 290 | UTR3 | Trans | |
| TCONS_00194652 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000612986 | 612 | 296 | UTR5 | Trans | |
| TCONS_00194655 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000612986 | 612 | 296 | UTR5 | Trans | |
| TCONS_00195633 | aspartylglucosaminidase | novel protein coding | ENST00000612986 | 520 | 288 | UTR3 | Trans | |
| TCONS_00204911 | erythrocyte membrane protein band 4.1 like 4A | novel noncoding | ENST00000612986 | 603 | 289 | noncoding | Trans | |
| TCONS_00213191 | tubby like protein 4 | novel protein coding | ENST00000612986 | 618 | 295 | UTR5 | Trans | |
| TCONS_00234854 | zinc finger and BTB domain containing 10 | novel protein coding | ENST00000612986 | 601 | 295 | UTR3 | Trans | |
| TCONS_00240045 | zinc finger protein 706 | novel protein coding | ENST00000612986 | 649 | 294 | UTR3 | Trans | |
| TCONS_00240046 | zinc finger protein 706 | novel protein coding | ENST00000612986 | 649 | 294 | UTR5 | Trans | |
| TCONS_00251977 | G protein-coupled receptor 82 | novel protein coding | ENST00000612986 | 532 | 315 | UTR3 | Trans |
>TCONS_00251977 (1089 nt)
AGGGAGCAGCCTGTTCTGCCAAATCACACAAGGGCATGTGTTTTCATGACATTATTGCTTTTGAGTGTGCTGGCCTAGCAATAATATGATTTTTTTTTCC
TAAGTGGAAATTGTAATATTTAAGTATTAATACCTCTGTTTAAGGTTCATTTTGAACGCCTTGGTGACCCTATGTTTTTTTCTTTGTTTTTTGTTTTGTT
TTTTTTTTTTTTGTTTTTTTTTTTTGTTTTTTTGAGATGAAGTCTTCCTCTGTTGCCCAGGCTGGAGTGCAGTGGCGCATTCTTGGCTCACTGCAACCTT
CGCCTCCCAGGTTGAAGCAATTCTTCTGCCTCAGCCTCTCGAGTAGCTGGGAGTCCAGGCACCTGCCAACACGTCTGGCTAATTTTTGTATTTTTAGTAG
AGATGGGGTTTCACCATCTTGGCCAGGCTGGTCTTGAACTCCTGACCTCATGATCCACCCGTTTCGGCCTCCCAAAATGCTGCGATTACAGGCGTGAGCT
ACTGCACCCGCAACCCTATGTTTTTTTCTAAGAATATAGTGTCCCTTGCCCCCTGCTACAAGCCTTACCCAGTGTTACATAATTTATTGTAATTAAATTG
TTTATTAATGATACATTCTTGCTGTAGAAGAAAACGTGTCCTTTTGGGCTCAGTACAGTATATGTTTCTTAAGTAAGAGGGATCATATTAAACCAGCTAC
TTAATGTGAAGCAGATAGCCAGTGTTCTCCATGTACAATCTTAGGGAGGGTAATTTTTGTTTTGGCTGTGTAATTATGGTTTGAGGCAGCCCATTAATCG
CATATTTCAGCTGTCAAATAGAAATTTGGCCCAGAAAGGAATACACTTTGGCTTTACAAAACTGCTTATTTTCAAATTTTTAAATGGGGACAAAAACGAA
TATGCTATATTATATACTTTTATTTATATAATTTTTTTTTCAGCAACTTTTTCTCTTTTGAAAATGCAAGAGCCTGAAAAACATTGTGAATATACTTGTA
ACATTGCAAAGCTATTTCACCAGAGTAAAGATATTTTGGTTGTTCATATACGAGTGTGTTCGTTGTTTATCTAATAAATTGTTAAAACTA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.