| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000399120 | holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) | protein coding | ENST00000616838 | 506 | 300 | UTR5 | Trans | |
| ENST00000427746 | holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) | protein coding | ENST00000616838 | 506 | 300 | UTR5 | Trans | |
| ENST00000511184 | E74-like factor 2 (ets domain transcription factor) | nonsense mediated decay | ENST00000616838 | 546 | 297 | CDS_UTR | Trans | |
| ENST00000521027 | pleckstrin and Sec7 domain containing 3 | protein coding | ENST00000616838 | 523 | 300 | CDS_UTR | Trans | |
| ENST00000572705 | transient receptor potential cation channel, subfamily V, member 1 | protein coding | ENST00000616838 | 614 | 295 | UTR3 | Trans | |
| ENST00000593250 | centrosomal protein 76kDa | nonsense mediated decay | ENST00000616838 | 548 | 300 | UTR3 | Trans | |
| ENST00000607772 | CNKSR family member 3 | protein coding | ENST00000616838 | 600 | 285 | UTR3 | Trans | |
| TCONS_00026285 | cytochrome P450, family 26, subfamily A, polypeptide 1 | novel protein coding | ENST00000616838 | 510 | 291 | UTR3 | Trans | |
| TCONS_00067572 | DCN1, defective in cullin neddylation 1, domain containing 2 | novel protein coding | ENST00000616838 | 615 | 299 | UTR3 | Trans | |
| TCONS_00107851 | transient receptor potential cation channel, subfamily V, member 1 | novel protein coding | ENST00000616838 | 614 | 295 | UTR3 | Trans | |
| TCONS_00109011 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000616838 | 516 | 290 | UTR5 | Trans | |
| TCONS_00141404 | GLI family zinc finger 2 | novel protein coding | ENST00000616838 | 603 | 290 | UTR5 | Trans | |
| TCONS_00161482 | BTB and CNC homology 1, basic leucine zipper transcription factor 1 | novel protein coding | ENST00000616838 | 601 | 294 | UTR3 | Trans | |
| TCONS_00221037 | POU class 6 homeobox 2 | novel noncoding | ENST00000616838 | 607 | 300 | noncoding | Trans | |
| TCONS_00233718 | pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 | novel protein coding | ENST00000616838 | 604 | 287 | UTR5 | Trans | |
| TCONS_00240688 | metastasis suppressor 1 | novel protein coding | ENST00000616838 | 625 | 292 | CDS_UTR | Trans |
>TCONS_00240688 (581 nt)
CACTGCCCTCCAGCCTGGGCAACAAGAGCCAAACTCCCTGTCAAAAAAAAAAAAAAAGAAAGCAGTTGTTGGACAGTGGGTTGGCCATTCTTAGAACGAC
TTGGAGGCTTATTTTATTCTGGGTTGTTCTAAAAAGGACAGGACATTTACTGGTCATATGTGATAAAATAAATAGTCTATTAAATGAAATCTAATTATTG
TTAATCATTGATGCCCTATGGATAATGTCAAAAGTCATCAGACTGGGGATGGTGGCTCATGCCTGTAACCCCAGCACTTTGGTAGGATGAGGCCGGCGGA
TCACTTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACTTCTTACCTACTAAAAATACAAAAATTAGCCAGGTGTGGTGGTGTGCGCCTA
TAGTCCTGGCTACTTGAGAGGCTAAAGCAGAAGAATCGCTCGAACCTGGGAGATGGAGGTTGCAGTGAACCGAGATCACACCACTGCACTCCAGCCTGGG
TGACAGAGTGAGACTCTGTCTCAAAAAAAGAAAAAACAAAGCCATCAGTCTTGTAATTAAACGTGATTTGTCTTTATCCACA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.