Detailed information on ENST00000618809

lncRNA-RNA interactions

Number of interactions: 96

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000274276 oncostatin M receptor protein coding ENST00000618809 668 309 UTR3 Trans
ENST00000312828 ring finger protein 152 protein coding ENST00000618809 626 312 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000618809 656 295 UTR3 Trans
ENST00000353231 C-type lectin domain family 7, member A protein coding ENST00000618809 578 305 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding ENST00000618809 684 301 UTR3 Trans
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000618809 665 306 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000618809 572 296 noncoding Trans
ENST00000432564 hydroxycarboxylic acid receptor 1 protein coding ENST00000618809 604 293 UTR3 Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000618809 665 306 UTR3 Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000618809 686 308 noncoding Trans
ENST00000529743 lincRNA lincRNA ENST00000618809 652 304 noncoding Trans
ENST00000532572 protease, serine, 23 retained intron ENST00000618809 646 295 noncoding Trans
ENST00000534514 flavin containing monooxygenase 3 processed transcript ENST00000618809 594 308 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000618809 665 300 noncoding Trans
ENST00000561387 ubiquitin associated protein 1-like retained intron ENST00000618809 630 304 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000618809 662 300 UTR3 Trans
ENST00000590442 zinc finger protein 532 retained intron ENST00000618809 666 303 noncoding Trans
ENST00000604000 Lix1 homolog (chicken) like protein coding ENST00000618809 561 298 UTR3 Trans
ENST00000620788 pleckstrin homology-like domain, family B, member 1 retained intron ENST00000618809 611 304 noncoding Trans
TCONS_00006772 lincRNA novel protein coding ENST00000618809 652 302 UTR3 Trans
TCONS_00013935 platelet-activating factor receptor novel protein coding ENST00000618809 648 300 UTR3 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000618809 532 298 UTR3 Trans
TCONS_00025775 zinc finger, MIZ-type containing 1 novel protein coding ENST00000618809 532 298 UTR3 Trans
TCONS_00032153 long intergenic non-protein coding RNA 959 novel noncoding ENST00000618809 619 275 noncoding Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000618809 623 305 UTR5 Trans
TCONS_00050192 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000618809 643 306 UTR5 Trans
TCONS_00050209 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000618809 643 306 UTR5 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000618809 665 300 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000618809 665 300 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000618809 665 300 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000618809 665 300 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000618809 665 300 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000618809 665 300 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000618809 665 300 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000618809 665 300 UTR3 Trans
TCONS_00060110 chromosome 12 open reading frame 66 novel protein coding ENST00000618809 604 310 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000618809 654 291 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000618809 620 307 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000618809 654 291 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000618809 620 307 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000618809 620 307 UTR5 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000618809 604 267 UTR3 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000618809 660 301 UTR5 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding ENST00000618809 684 301 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding ENST00000618809 684 301 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding ENST00000618809 684 301 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000618809 603 302 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000618809 603 302 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000618809 615 287 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000618809 662 300 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000618809 687 290 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000618809 687 290 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000618809 615 287 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000618809 627 300 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000618809 627 300 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000618809 627 300 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000618809 627 300 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000618809 627 300 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000618809 627 300 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000618809 627 300 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000618809 623 307 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000618809 664 305 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000618809 626 312 UTR3 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000618809 714 299 UTR5 Trans
TCONS_00137691 FOS-like antigen 2 novel protein coding ENST00000618809 633 294 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000618809 651 296 UTR5 Trans
TCONS_00142538 antisense novel protein coding ENST00000618809 663 302 UTR3 Trans
TCONS_00143295 nucleoporin 35kDa novel protein coding ENST00000618809 647 306 UTR3 Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000618809 648 286 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000618809 648 286 UTR3 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000618809 635 305 UTR5 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000618809 615 292 UTR5 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000618809 662 286 noncoding Trans
TCONS_00174508 calcium-sensing receptor novel protein coding ENST00000618809 671 304 UTR5 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000618809 626 292 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000618809 624 264 UTR3 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000618809 633 302 UTR3 Trans
TCONS_00195828 LRP2 binding protein novel protein coding ENST00000618809 631 290 UTR5 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000618809 612 289 UTR5 Trans
TCONS_00198052 NSA2 ribosome biogenesis homolog (S. cerevisiae) novel protein coding ENST00000618809 600 278 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000618809 602 293 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000618809 606 306 UTR5 Trans
TCONS_00203989 family with sequence similarity 169, member A novel protein coding ENST00000618809 606 306 UTR3 Trans
TCONS_00205414 prolyl 4-hydroxylase, alpha polypeptide II novel protein coding ENST00000618809 607 308 UTR3 Trans
TCONS_00210636 polymerase (DNA directed), eta novel noncoding ENST00000618809 608 279 noncoding Trans
TCONS_00211226 antisense novel protein coding ENST00000618809 608 265 UTR5 Trans
TCONS_00216783 KH homology domain containing 1 novel noncoding ENST00000618809 650 307 noncoding Trans
TCONS_00219475 WD repeat domain 27 novel protein coding ENST00000618809 604 303 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000618809 621 282 UTR5 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000618809 662 303 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000618809 662 303 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000618809 662 303 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000618809 708 311 UTR3 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000618809 656 295 UTR3 Trans
TCONS_00251973 G protein-coupled receptor 34 novel protein coding ENST00000618809 607 292 UTR3 Trans
TCONS_00253055 uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) novel protein coding ENST00000618809 637 311 UTR3 Trans

Sequence

>TCONS_00253055 (656 nt)
CAAAAGGCCCACTAGGTGGAGTGAAATGGATCAGGAGCAATTATGTTCAATTTCACCTTTAAGTTTTCTCAAAAGGAGGAGCATTAAGAATCAGCCACCT
TAGTACATACTTAAAGGAGAAGATAGTCATTGGACAAAAGGTGGGTCATTCTCACGTTGACCAAGTTTCTGTTCCAGTATCACCCTCCCAGGAGCAAGTT
GAGAAACAACTGCAGGAATCCAGCTGATGAACATCTATCTATAATCCTAAAGGTTGGCCGGGCGTGGTGGCTCACGCCTGTGATCCTAGCACTTTGGGAG
GCCTAGGCAGGTGGATCACCTGAGGTCCAGAGTTCGAGACCAGCCTGGCCAACATGGAGAAACCCCGCCTCTACTAAAAATACAAAATTAGCTGGGCGTG
GTGGCGCATGCCTGTAATCCCAGCTGCTCCGGAGGCTGAGGCAGGAGAATGGCTTGAGCCTGGGAGTTAGAGGTTGTGGTGAGCCGAGATAGCGCCATTG
CACTCCACCCTGGGCAACAAGAGTAAGACTCCGTCTCAAAAAAAGAAAAGAAAAAAAATAAATCCTAAAGGTTGACTAAACTGCATTAGAGAAGCAGCTC
AACCTGTGGCTACAAGCCTACCACTTTTCCTTCAGAATTAAACACTTCCATCCCCAA

Expression



Full and truncated open reading frames discovered in TCONS_00253055

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.