| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000276431 | tumor necrosis factor receptor superfamily, member 10b | protein coding | ENST00000619713 | 525 | 281 | UTR3 | Trans | |
| ENST00000494969 | colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) | protein coding | ENST00000619713 | 533 | 292 | CDS | Trans | |
| ENST00000517408 | antisense | antisense | ENST00000619713 | 506 | 295 | noncoding | Trans | |
| TCONS_00025758 | zinc finger, MIZ-type containing 1 | novel protein coding | ENST00000619713 | 628 | 289 | UTR5 | Trans | |
| TCONS_00025760 | zinc finger, MIZ-type containing 1 | novel protein coding | ENST00000619713 | 628 | 289 | UTR5 | Trans | |
| TCONS_00025761 | zinc finger, MIZ-type containing 1 | novel protein coding | ENST00000619713 | 628 | 289 | UTR5 | Trans | |
| TCONS_00082423 | transcribed_processed_pseudogene | novel protein coding | ENST00000619713 | 504 | 299 | UTR3 | Trans | |
| TCONS_00202516 | family with sequence similarity 173, member B | novel protein coding | ENST00000619713 | 643 | 295 | UTR5 | Trans | |
| TCONS_00240688 | metastasis suppressor 1 | novel protein coding | ENST00000619713 | 612 | 295 | CDS_UTR | Trans |
>TCONS_00240688 (560 nt)
TATTATATGAAAATCTATGGACTGGGCACAGTGGCTCATGCCTGTAATTCCAACACTTCGGGAGACCAAGGCAGACAGATCACTTGAGGTCAGGAGTTGG
AGACCAGCCTGGCCAACATGGCAAAACCCCATCTCTACTAAAAATACAAAAATTAGCTGGGTGTGGTGGTGGTGCGTGCCTGTAATCCCAGCTACTCAGG
AGACTGAGGCAAGAGAATCGCTTGGACCCGGGAGGTGGAGGTTGCACTGAGCCAAGATCATGCCACTGCATTCCAGCCTGGGCAACAGAGCAAGACTCTG
TCTCAAAAGAAAACGTGAAAGTTTAGTACTAGGACTATTAAATTGAATAAGTGGTTAATAATCTTCCCATTACAAAAATACATAGTCAGATGATTTGGCA
GGCTTGTCTACCAAACTTTCAAGCAACAAATCATCTGTTTATACAAATTCTTCTGGGCATTGAAGAAAGAGGGACTACTTCAGCTCATCTTGAGAGGGTA
ACGTAACCCTGCTAAATCCAGAGACGCACATTACCAAAACAAAATCACGGGTCTACTACAT
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.