Detailed information on TCONS_00000643

lncRNA-RNA interactions

Number of interactions: 102

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000261653 syntaxin 2 protein coding TCONS_00000643 503 299 UTR3 Trans
ENST00000263955 serine/threonine kinase 17b protein coding TCONS_00000643 618 302 UTR3 Trans
ENST00000276431 tumor necrosis factor receptor superfamily, member 10b protein coding TCONS_00000643 544 251 UTR3 Trans
ENST00000280800 phospholipase B domain containing 2 protein coding TCONS_00000643 625 309 UTR3 Trans
ENST00000312828 ring finger protein 152 protein coding TCONS_00000643 611 285 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding TCONS_00000643 667 298 UTR3 Trans
ENST00000353231 C-type lectin domain family 7, member A protein coding TCONS_00000643 625 308 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding TCONS_00000643 699 309 UTR3 Trans
ENST00000367097 tubby like protein 4 protein coding TCONS_00000643 524 319 UTR3 Trans
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding TCONS_00000643 659 301 UTR3 Trans
ENST00000382044 tumor protein p53 binding protein 1 protein coding TCONS_00000643 663 314 UTR3 Trans
ENST00000392373 syntaxin 2 protein coding TCONS_00000643 503 299 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript TCONS_00000643 555 285 noncoding Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding TCONS_00000643 659 301 UTR3 Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense TCONS_00000643 663 308 noncoding Trans
ENST00000534514 flavin containing monooxygenase 3 processed transcript TCONS_00000643 595 304 noncoding Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay TCONS_00000643 606 269 UTR3 Trans
ENST00000555658 forkhead box N3 processed transcript TCONS_00000643 538 301 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript TCONS_00000643 677 301 noncoding Trans
ENST00000561387 ubiquitin associated protein 1-like retained intron TCONS_00000643 678 307 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding TCONS_00000643 570 302 UTR3 Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding TCONS_00000643 687 301 UTR3 Trans
ENST00000579685 adenomatosis polyposis coli down-regulated 1 nonsense mediated decay TCONS_00000643 516 272 CDS Trans
ENST00000587344 sense_intronic sense intronic TCONS_00000643 635 312 noncoding Trans
ENST00000590442 zinc finger protein 532 retained intron TCONS_00000643 600 299 noncoding Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay TCONS_00000643 544 263 UTR3 Trans
ENST00000607772 CNKSR family member 3 protein coding TCONS_00000643 653 302 UTR3 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding TCONS_00000643 646 299 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding TCONS_00000643 646 299 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding TCONS_00000643 656 279 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding TCONS_00000643 629 309 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding TCONS_00000643 603 286 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding TCONS_00000643 603 286 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding TCONS_00000643 606 269 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding TCONS_00000643 633 308 UTR5 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00000643 677 301 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00000643 677 301 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00000643 677 301 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00000643 677 301 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00000643 677 301 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00000643 677 301 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00000643 677 301 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00000643 677 301 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding TCONS_00000643 668 311 UTR3 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding TCONS_00000643 635 284 UTR5 Trans
TCONS_00078200 GTP cyclohydrolase I feedback regulator novel protein coding TCONS_00000643 581 315 UTR3 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding TCONS_00000643 671 309 UTR5 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding TCONS_00000643 517 304 UTR3 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding TCONS_00000643 699 309 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding TCONS_00000643 699 309 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding TCONS_00000643 699 309 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding TCONS_00000643 616 308 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding TCONS_00000643 616 308 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding TCONS_00000643 570 302 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding TCONS_00000643 687 301 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding TCONS_00000643 631 269 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding TCONS_00000643 631 269 UTR3 Trans
TCONS_00114623 glutamine rich 2 novel protein coding TCONS_00000643 616 310 UTR5 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding TCONS_00000643 616 310 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding TCONS_00000643 674 310 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding TCONS_00000643 728 301 UTR5 Trans
TCONS_00119961 ring finger protein 152 novel protein coding TCONS_00000643 611 285 UTR3 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding TCONS_00000643 665 308 noncoding Trans
TCONS_00132247 zinc finger protein 43 novel noncoding TCONS_00000643 617 298 noncoding Trans
TCONS_00135884 zinc finger protein 347 novel protein coding TCONS_00000643 709 307 UTR5 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00000643 646 299 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00000643 646 299 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00000643 646 299 UTR5 Trans
TCONS_00143295 nucleoporin 35kDa novel protein coding TCONS_00000643 626 309 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding TCONS_00000643 601 309 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding TCONS_00000643 641 301 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding TCONS_00000643 633 302 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding TCONS_00000643 633 283 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding TCONS_00000643 601 309 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding TCONS_00000643 633 302 UTR3 Trans
TCONS_00147106 ATPase family, AAA domain containing 2B novel protein coding TCONS_00000643 601 309 UTR3 Trans
TCONS_00147106 ATPase family, AAA domain containing 2B novel protein coding TCONS_00000643 633 302 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding TCONS_00000643 618 302 UTR3 Trans
TCONS_00159938 zinc fingers and homeoboxes 3 novel protein coding TCONS_00000643 610 307 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding TCONS_00000643 651 283 noncoding Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding TCONS_00000643 620 302 UTR5 Trans
TCONS_00174508 calcium-sensing receptor novel protein coding TCONS_00000643 653 298 UTR5 Trans
TCONS_00175246 interleukin 20 receptor beta novel protein coding TCONS_00000643 657 305 UTR5 Trans
TCONS_00185321 transferrin receptor novel protein coding TCONS_00000643 608 296 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding TCONS_00000643 611 309 UTR3 Trans
TCONS_00187165 NEDD4 binding protein 2 novel protein coding TCONS_00000643 603 305 UTR3 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding TCONS_00000643 631 275 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding TCONS_00000643 642 283 UTR3 Trans
TCONS_00198052 NSA2 ribosome biogenesis homolog (S. cerevisiae) novel protein coding TCONS_00000643 606 281 UTR3 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding TCONS_00000643 612 311 UTR3 Trans
TCONS_00219475 WD repeat domain 27 novel protein coding TCONS_00000643 603 299 UTR3 Trans
TCONS_00225245 family with sequence similarity 115, member C novel protein coding TCONS_00000643 569 302 UTR3 Trans
TCONS_00225248 family with sequence similarity 115, member C novel protein coding TCONS_00000643 569 302 UTR3 Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding TCONS_00000643 648 297 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding TCONS_00000643 601 283 UTR5 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding TCONS_00000643 678 314 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding TCONS_00000643 678 314 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding TCONS_00000643 678 314 UTR3 Trans
TCONS_00235685 oxidation resistance 1 novel protein coding TCONS_00000643 665 312 UTR3 Trans
TCONS_00246881 cyclin-dependent kinase inhibitor 2A novel protein coding TCONS_00000643 610 309 UTR5 Trans
TCONS_00249090 transmembrane protein 245 novel protein coding TCONS_00000643 603 304 UTR3 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding TCONS_00000643 667 298 UTR3 Trans

Sequence

>TCONS_00249683 (3743 nt)
GGAAGGGGCAAGGGCGGGGCGGCGAGACGCTTCCCGGAGGAAGTGAGCTGCCCGCCCGCAGCCCGCTCCTCGCCCCTTCCCTTTCTAGTCCCCGACGTCC
CTGAGAGGAATGGGGACGACAGCCCTGGTTCGGGAGCGCCCGCTCTCGGCCCGGTGCTGCGCTGGGCCCCAGAAGTTGCGAAAGAAAGGACCTCGGCCCT
GTCCTGAGCCCCTGTGGGCCGAAGAGCTCCTTGCCTAGCTAGGGGCATCTGCACTGGAAAGATCACTTAACCGTGGGCCTTCGCTCTCTTAAGCGAAAGC
ACGTTGCAAACCCCTGCTTCCAGTGGTAAGACTCAGAGAATGCTAATGGTTAAGAATCACAAGGACTCCCTCTTCCACCTCCATTCTGCTCATTGCTCAC
CGTCGGAGGAAGCCCCGGGTTTCTTCCAGGAGCTGGGGACCCCCCTCGAATGTTCCTGCTGAGGCTGCTGTGCCAATAGATCACAGTGGTTAAGATCTAG
AGCCAAGGTACACAGGACCTGATCTAAAAACAAGCTGTCCTGCAGCCAGCTGTGTTGACTCTCTAAACCTCACTTTACTCATTTGTAAAATAGGAGTAAT
ATTCCCCTCAGAGAGTTATGAGGGTTAAAGGAGGAAAAGCATGGAAAGAGTCTAGCGCCACGGCATGGTCCTTACTTATCTACCAGATACTAAACTCCGT
GAGGACGGTGATGAGATCTGTTGTAGCCCTGGTCATTGACACATGACAGATGTAAAGTGACTGTTCAAACAGCCCATCAGACTGTTGTATACCAAGGCAC
ATGCTAGGTGCTATCTAGGATACAGAGAAGAGAGTAAGAAGACCCAGGAACCTGTGATCTATTCGAGGAGGCGGGACTTTATACCTGAAAAACCAAAGTG
ATACTTTCCAAGTAATGGAGCCAATAATGACTTCAGAGTCAGAGTGGTTAAGAAAGATCTGCATGGGGAGAAATAAAGCCTTTGATGAAGATTTTAAAAG
ATGAGTACCTTCCTGGGCCGGGCGCGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGTGGACGGATCACTTGAGGTCAGGAGTTCGAGAC
CAGCTTGACCAACATGGTGAAACCCCGTCTCTACTAAAAAATACAAAATTAGCCGGGCGTGGTGGCACATGCCTGTAATCCCAGCTGCTTGGGAGACTGA
GGCAAGAGAATTGCTTGGACCCAGGAAGCGGAGGTTACAGTGAGCCGAGATCGCGCCATTGCACTCCAGCCCGGGCAACAGGAGCGAAACTCCGTCTCTC
AAAAGAGGGGGAAAAAGAAAGAGTACCTTCCTAAAAGAGGAGGCATTTCTTCAACACACCTTTCCACTCACACCACCCACTCCCTGCATCCCAGTGTTCC
TGACTCTGTTTCTGTAAATTAATCTATTTTTCCATATTGGAAAAAGGGCATTCTGTAACTGTTTGTAACTATGAAAACAGTTCCTTCCACAATGAAAAGA
TCAGGAAAGTACTGAGTACATTCAAGCAGATGTGTGCCTTAGAACAAGTTTCAAAAAAGGACAGTAGAGCTTACCTATCGTGGGATCAGATACTTCAGGG
ATACAAAGTCTACAGGTCCAACTGCTGCCACTGGCAGTAATCGAAGACTTCAGCAGACACAAAATCAAGTAGATGAGGTGGTGGACATAATGCGAGTTAA
CGTGGACAAGGTTCTGGAAAGAGACCAGAAGCTCTCTGAGTTAGACGACCGTGCAGACGCACTGCAGGCAGGCGCTTCTCAATTTGAAACGAGCGCAGCC
AAGTTGAAGAGGAAATATTGGTGGAAGAATTGCAAGATGTGGGCAATCGGGATTACTGTTCTGGTTATCTTCATCATCATCATCATCGTGTGGGTTGTCT
CTTCATGAAGAACCAGCGGAACTCAAAACTGCTGTTCAAGAAACCTCTTCAAGACTTTTGACTTAGAACCTGCTATATTATCAAGCTTACCTACTGTTAT
CTCTAAAATTTTTTTTGTGTTAATGTAAAGTTGAATTTCTAGGAAACGTGCCTTTGTTTTTTAATATGCACTCCAAATTAGAAGGCCGGCCCCGTCCACA
TTTTGCACAGTGCCTTTACAGATTTACGTATGGGCTGATGAAGAGGCCTTCTTAAGTTCCAGAGTGCTATAATCTAGATGTAATGTTGTCACTAATTAAT
TGCCATTACTCCCAGTTAGTTACCCTTGTCATTTGGCATTATTTTCAGAACCACATTTTAAACCTTTGGGTAATCAGATTTCCAACTTATGCCTTCCAGA
AAAAAACACTACTGCCTAACACAAATCTGTGATAACAACAGGCTGTGCCTTATTTTGATAATTTTCTGATTCCCTAGAAGAGAACCCTCTACTTTTTGTA
AGCACTACTGACTCTCGCTGTATTTAAGATGCTGGTGAAGAGCTTTTGCTCTTGCATTAGATTTGAAGATGTTTACATTGTTGTTATTGTTATGTATCAC
TTGCTAAAAATATTGTTTTAATCAGAGATAACCTCTTTAAAAAAATTTTTAAAGAACTATGGCTATGACCAAAGCTTCTATTTTGCCAAAAAGTTAAATA
CCGATAAAATGGCCTTAAGTGTATTCCTGACAGTTAAATTCAGAAACGTGCCAAATGGAACTCAAGGTGCCCCTTCAGAATTAAAATCATTACCTTGTGT
GTGAACCTTCTACATCTTCATAGGCCTTTCTTCCTTTTGAAAGGCTGTAGACAGTGTGGCTCCCCTTCTGATTCAGTATTTTGCATGGGGGTTAGAGAAG
GTTTGAGGTAGACTCTGACCGTCTCATAAAAGAGTTCTACCCAGCAGTTGGCAGATTATCAGCTGTGGACTCCAGCATGTTTCTGATAATTATGCAAGCA
ACAATTCTGTAGCCTCAAGTAAGACCACCTGTGAACTTGATCATTATCTGGCCCAAATATGAAGATAAACTATAACTTTGGAGTTTGTTTCCTATTTGTA
TTCACATTCTGCTTCCTAAATCAGTTTTCTAAATTATGCCTGCAATTAGGCATTGGTCAGGGGTGAATGGCTCTTTTCACAGAGAGTAGCCAACCAGAGA
CCTTTGCTTTGATATCATCAACTGCAGAGAATGCTGTTGATGGGAATGCTGGAAGCAGAAACTTTGTCATCGGAAAAACTTTTCTTGTATGCATGAGACT
CAACATCAGGATCCACAGCTTAAAGATGGGAATTCAGGTATGAAAGAAAACAGGCAAGGAGGCACTGAGGGAGAAAGACACAGACTTTATCGCTCTGTGG
CTCATTGTTACTGGAATATTCTAAAACTCTTGTTCACATGCTATTATGACTTATAAAGCAGCAACAGCTGAGGCGCACCAGGACACAGCTTCCATTTCTT
TAACGTCTGTTCCCTTAACATCGCTGAAATGATTTACTGTTGAAGAGATGCCTTGCGGTGTGGCCAGCTGTGAGGAGAAAGCAGCTGGCAGTGTTAGGAC
ATTAGTCCACCTTCAGCGCAGGGTCTCTGGCCGGGTCTGACTCAGAAACCTTGGTACTCGCCCCTTGGCCACAGTGCCCAGACCCATGTAACCCACTGGC
TCCTGCATTAACCCAGAAATACCTCGCTTCTATCTGTGCACTTAGCTGGGAACTTACCCACTGTAATCACCTAAATAAAGTGTTTATAAACATGATTGTG
GCACCTGTGCTCCTTGTAGAGGAATAGCTGCACCTGGTCCGAGT

Expression



Full and truncated open reading frames discovered in TCONS_00249683

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.