Detailed information on TCONS_00035086

lncRNA-RNA interactions

Number of interactions: 2

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding TCONS_00035086 741 295 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding TCONS_00035086 741 295 UTR3 Trans

Sequence

>TCONS_00148705 (293 nt)
TTTTCTTAATCCAGTCTATCATTGTTGGACATTTGGGTTGGTTCCAAGTCTTTGCTATTGTGAATAGTGCCGCAATAAACATAAGTGTGCATGTGTCTTT
ATAGCAGCATGATTTATAATCCTTTGGGTATATACCCAGTAATGGGATGGCTGGGTCAAATGGTATTTCTAGTTCTAGATCCCTGAGGAATCGCCACACT
GACTTCCACAATGGTTGAACTAGTTTACAGTCCCACCAACAGTGTAAAAGTGTTCCTATTTCTCCACATCCTCTCCAGCACCTGTTGTTTCCTG

Expression



Full and truncated open reading frames discovered in TCONS_00148705

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.