Detailed information on TCONS_00035899

lncRNA-RNA interactions

Number of interactions: 2

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
TCONS_00138868 WD repeat containing planar cell polarity effector novel protein coding TCONS_00035899 646 241 UTR3 Trans
TCONS_00138868 WD repeat containing planar cell polarity effector novel protein coding TCONS_00035899 613 241 UTR3 Trans

Sequence

>TCONS_00138868 (240 nt)
GGAAGGGATCCAGTTTTAGCTTTCTACATATGGCTAGCCAGTTTTCCCAGCACCATTTATTAAATAGGGAATCCTTTCCCCATTTCTTGTTTTTGTCAGG
TTTGTCAAAGATCAGATGGTTGTAGATGTGTGGTGTTATTTCTGAGGCCTCTGTTCTGTTCCATTGGTCTATATCTCTGTTTTGGTACCAGTACCATGCT
GTTTTGGTTACTGTAGCCTTGTAGTGTAGTTTGAAGTCAGG

Expression



Full and truncated open reading frames discovered in TCONS_00138868

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.