Detailed information on TCONS_00050072

lncRNA-RNA interactions

Number of interactions: 2

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding TCONS_00050072 562 226 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding TCONS_00050072 562 226 UTR3 Trans

Sequence

>TCONS_00148705 (224 nt)
CCAGTCTATCATTGATGGACATTTGGGTTGGTTCCAAGTCTTTGCTATTGTGAATAGTGCTGCAATAAACATACGTGTGCATGTGTCTTTATAGCAGCAT
GATTTATAATCCTTTGGGTATATATCCAGTAATGGGATGGCTGGGTCAAATGGTATTTCTAGTTCTAGATCCCTGAGGAATCGCCACACTGACTTCCACA
ATGGTTGAACTAGTTTACAGTCCCA

Expression



Full and truncated open reading frames discovered in TCONS_00148705

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.