Detailed information on TCONS_00113235

lncRNA-RNA interactions

Number of interactions: 70

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000371065 leptin receptor overlapping transcript protein coding TCONS_00113235 600 322 UTR3 Trans
ENST00000448612 WD repeat domain 27 protein coding TCONS_00113235 505 312 CDS Trans
ENST00000467462 inter-alpha-trypsin inhibitor heavy chain family, member 4 processed transcript TCONS_00113235 561 302 noncoding Trans
ENST00000470361 potassium large conductance calcium-activated channel, subfamily M, beta member 2 processed transcript TCONS_00113235 510 301 noncoding Trans
ENST00000553936 gephyrin nonsense mediated decay TCONS_00113235 630 309 CDS_UTR Trans
ENST00000569455 cadherin 13 processed transcript TCONS_00113235 597 306 noncoding Trans
ENST00000604000 Lix1 homolog (chicken) like protein coding TCONS_00113235 645 294 UTR3 Trans
ENST00000620139 melanoregulin protein coding TCONS_00113235 571 303 UTR3 Trans
TCONS_00001594 lincRNA novel protein coding TCONS_00113235 603 291 UTR5 Trans
TCONS_00008112 nicastrin novel protein coding TCONS_00113235 639 322 UTR3 Trans
TCONS_00033132 dynein heavy chain domain 1 novel protein coding TCONS_00113235 645 307 UTR5 Trans
TCONS_00034643 CD82 molecule novel protein coding TCONS_00113235 627 288 UTR3 Trans
TCONS_00061878 transmembrane protein 116 novel protein coding TCONS_00113235 592 326 UTR3 Trans
TCONS_00075813 forkhead box N3 novel protein coding TCONS_00113235 621 305 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding TCONS_00113235 621 305 UTR3 Trans
TCONS_00075840 forkhead box N3 novel protein coding TCONS_00113235 583 313 UTR3 Trans
TCONS_00075841 forkhead box N3 novel protein coding TCONS_00113235 583 313 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding TCONS_00113235 645 306 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding TCONS_00113235 648 285 UTR3 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding TCONS_00113235 501 281 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 614 289 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 637 301 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 637 301 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 614 289 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 637 301 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 643 303 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 547 303 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 637 301 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 614 289 UTR3 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 637 301 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 614 289 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 614 289 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 637 301 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 614 289 UTR3 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00113235 637 301 UTR5 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding TCONS_00113235 638 307 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding TCONS_00113235 652 314 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding TCONS_00113235 608 287 UTR5 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00113235 610 306 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00113235 610 306 UTR3 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00113235 610 306 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00113235 610 306 UTR3 Trans
TCONS_00141681 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00113235 610 306 UTR3 Trans
TCONS_00150689 ectodysplasin A receptor novel protein coding TCONS_00113235 631 314 UTR3 Trans
TCONS_00152107 cordon-bleu WH2 repeat protein-like 1 novel protein coding TCONS_00113235 605 295 UTR5 Trans
TCONS_00152126 cordon-bleu WH2 repeat protein-like 1 novel protein coding TCONS_00113235 605 295 UTR5 Trans
TCONS_00152127 cordon-bleu WH2 repeat protein-like 1 novel protein coding TCONS_00113235 605 295 UTR5 Trans
TCONS_00159951 zinc fingers and homeoboxes 3 novel protein coding TCONS_00113235 620 300 UTR5 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding TCONS_00113235 670 314 UTR3 Trans
TCONS_00175515 transient receptor potential cation channel, subfamily C, member 1 novel protein coding TCONS_00113235 619 311 UTR5 Trans
TCONS_00182243 homogentisate 1,2-dioxygenase novel protein coding TCONS_00113235 620 306 UTR3 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding TCONS_00113235 623 302 UTR3 Trans
TCONS_00196430 trio Rho guanine nucleotide exchange factor novel protein coding TCONS_00113235 605 289 UTR3 Trans
TCONS_00196432 trio Rho guanine nucleotide exchange factor novel protein coding TCONS_00113235 605 289 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding TCONS_00113235 629 290 UTR3 Trans
TCONS_00219475 WD repeat domain 27 novel protein coding TCONS_00113235 505 312 UTR3 Trans
TCONS_00222612 carnitine O-octanoyltransferase novel protein coding TCONS_00113235 544 304 UTR3 Trans
TCONS_00222619 carnitine O-octanoyltransferase novel protein coding TCONS_00113235 544 304 UTR3 Trans
TCONS_00222623 carnitine O-octanoyltransferase novel protein coding TCONS_00113235 544 304 UTR3 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding TCONS_00113235 629 316 UTR5 Trans
TCONS_00235685 oxidation resistance 1 novel protein coding TCONS_00113235 617 316 UTR3 Trans
TCONS_00235698 oxidation resistance 1 novel protein coding TCONS_00113235 617 316 UTR3 Trans
TCONS_00235699 oxidation resistance 1 novel protein coding TCONS_00113235 617 316 UTR3 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding TCONS_00113235 617 316 UTR3 Trans
TCONS_00237103 cathepsin B novel protein coding TCONS_00113235 605 300 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding TCONS_00113235 612 295 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding TCONS_00113235 616 266 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding TCONS_00113235 628 294 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding TCONS_00113235 628 294 UTR5 Trans
TCONS_00249285 zinc finger protein 883 novel protein coding TCONS_00113235 677 315 UTR3 Trans

Sequence

>TCONS_00249285 (2022 nt)
GGGGGAAGAAGAAAAGAGGATGCCAGTCCTTGTTCCTAGGCCAAGACCTGAGCCCTGTAATATTAATATTTGGATCTAAAATCAGCCTTCCAACAGCAAC
ATGAAGTTGGCAGCCTTCCTCCTCCTGTGATCCTCATCATCTTCAGCCTAGAGGTACAAGAGCTTCAGGCTGCAGGAGACCGGCTTTTGGATACTGCTAA
TCAGTCCTAGCACTCTTTCTCTTTGAACCTGGACAAGGTGTCTGACCCTTCTCAACACAGCATCAGACAGCCACCTCTATTGACTGAAGTTGACAATGGA
GAATAAAACTCATTACCCCTGCTGAATCCAGGGGCCCCTTTTTACAGATGAGAAAAGTTCCAGAAAGACCCAGAGACATAATCAGGTACCTGCGTCGAGC
TCTGCACAGGTGACTGGGACTGCAACCCCGGAGACCACTGTGTCAGCAATGGGTGTGGCCATGAGTGTGTTGCAGGGTAAGGACAGGTAAAAACACCAGG
CCCTCCCTGCTTTCTGAAACGTTGTTCAGTCTAGGTAGGTTGTGCACTTGGTCTCAGTGGGACTTTCCAGAAATGAGTAGGACAGAAACCTACCTGTCTC
CCTCTTCCCCCACCCTTCCCAAGAAAAAGATGCATCCATCACAGGCTGGTGGTTTCCACACCTTTAAAATAATTCCCTAACCCAGTATGCCCTGGAGAAA
AATTGGACTATTTACTTAAGCAAAATGATAAAAATCACACATAATCCCCCACCCCAAAACAATGTCTGCTTAACACTTTGGTGCATATTTTAAACATACA
CAAATATGTAATATTTATATAAAAATGAGATAATCATGTGCCTATTTTTATTTTTTATTTCACTTAAAAGTAGCTACCAAACAACTTTTAATGTCAATAC
TAATGCTTCTATCCCATCATCTTTGATAACCTATAGAAGTTCATCAGCTATGCTCAGATACTTAGCAACCTTTAGTAATACATGTTTAAGATATTTCTTA
TTTTGATATTATGAATATGATTGTAACAAATACTAAATTGGCATACACACACTTATTAACTTCCTTGGGACAAATTCTAAGATGTAAAATTGATGACTAA
AGAGTATGTTCATTGGTCGGGCCCGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGCGGATCACGAGGTCAGGAGATCGAGACTAT
AATGGCTAACATGGTGAAACCCTGCCTCTACTAAAAATACAAAAAAAATTAGCCAGATGTGGTGGGGGCACCTGTAGTCCCAGATACTCAGGAGGCCGAG
CCAGGAGAATGGCGTGAACCTGGGAGGTGGAGCTTGCAGTGAGCCGAGATCGCACCACTGCACACCAGCCTGGGCAACAGAGGGAGACTCCATCTCAAAA
AATAAAAATAAAAATAAAAATAAAGAGTATGTTCATTTTAACCCTGTGATGTACATTGCCATGTTGACTTATGAGAACCCCTTTTCTGTGAAAATATCTC
AGGGGCCTCACAGGATAATTTATTTGTTTTCAGTAGCCATTAGTTGAAAAATGCATAATAAAAAGCTACCAGTTTTGATTATAAACTAAGTTGCACTAAA
CACAACAGAATCAGCATACACTTTAAATAAAAACCCTTTGTGTTCAGAATGTATTGTTTGGCCAATCCACCTGCAATCCTTGGACTGCTTAGGGCCTGGC
TGGCTCTTTGCAGGTGTGATTGATTTCCCAAATTGGGAACTGTTGCCTCTTGATTGTATTCTGTGGATCCAGGTCCCCAAAACAGCAGGTCTCGGGCAAA
ATTTTTTTTGTCTTTTTCTCAGATGAAGAGTTATCTTAAGGATCATCTTTCCCTAAGATCGTCATCCCTTCCTGGAGTTCCTATCTTCCAAGATGTGACT
GTCTGGAGTTCCTTGACTAGGAAGATGGATGAAAACAGCAAGCCTGTGGATGGAGACTACAGGGGATATGGGAGGCAGGGAAGAGGGGTTGTTTCTTTTA
ATAAATCATCATTGTTAAAAGCA

Expression



Full and truncated open reading frames discovered in TCONS_00249285

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.