Detailed information on TCONS_00118188

lncRNA-RNA interactions

Number of interactions: 68

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000336505 suppressor of cancer cell invasion protein coding TCONS_00118188 667 294 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding TCONS_00118188 706 300 UTR3 Trans
ENST00000450928 antisense antisense TCONS_00118188 531 302 noncoding Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding TCONS_00118188 572 301 CDS Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense TCONS_00118188 659 299 noncoding Trans
ENST00000532572 protease, serine, 23 retained intron TCONS_00118188 606 290 noncoding Trans
ENST00000534514 flavin containing monooxygenase 3 processed transcript TCONS_00118188 557 303 noncoding Trans
ENST00000548404 transcribed_unprocessed_pseudogene processed transcript TCONS_00118188 546 275 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript TCONS_00118188 692 300 noncoding Trans
ENST00000561387 ubiquitin associated protein 1-like retained intron TCONS_00118188 604 300 noncoding Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay TCONS_00118188 502 264 UTR3 Trans
ENST00000590442 zinc finger protein 532 retained intron TCONS_00118188 627 297 noncoding Trans
ENST00000607772 CNKSR family member 3 protein coding TCONS_00118188 653 297 UTR3 Trans
ENST00000620788 pleckstrin homology-like domain, family B, member 1 retained intron TCONS_00118188 603 303 noncoding Trans
TCONS_00006772 lincRNA novel protein coding TCONS_00118188 600 301 UTR3 Trans
TCONS_00013935 platelet-activating factor receptor novel protein coding TCONS_00118188 650 297 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding TCONS_00118188 650 302 UTR5 Trans
TCONS_00050192 FYVE, RhoGEF and PH domain containing 4 novel protein coding TCONS_00118188 627 303 UTR5 Trans
TCONS_00050209 FYVE, RhoGEF and PH domain containing 4 novel protein coding TCONS_00118188 627 303 UTR5 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00118188 692 300 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00118188 692 300 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00118188 692 300 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00118188 692 300 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00118188 692 300 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00118188 692 300 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00118188 692 300 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding TCONS_00118188 692 300 UTR3 Trans
TCONS_00061180 golgin A2 pseudogene 5 novel protein coding TCONS_00118188 546 275 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding TCONS_00118188 655 293 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding TCONS_00118188 655 293 UTR5 Trans
TCONS_00065858 ubiquitin specific peptidase 12 novel protein coding TCONS_00118188 518 294 UTR3 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding TCONS_00118188 615 297 UTR5 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding TCONS_00118188 706 300 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding TCONS_00118188 706 300 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding TCONS_00118188 706 300 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding TCONS_00118188 680 288 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding TCONS_00118188 680 288 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00118188 628 299 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00118188 628 299 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00118188 628 299 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00118188 628 299 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00118188 628 299 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00118188 628 299 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00118188 628 299 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding TCONS_00118188 648 302 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding TCONS_00118188 637 304 UTR3 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding TCONS_00118188 668 302 noncoding Trans
TCONS_00132247 zinc finger protein 43 novel noncoding TCONS_00118188 635 295 noncoding Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding TCONS_00118188 666 294 UTR5 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00118188 604 296 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00118188 604 296 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00118188 604 296 UTR5 Trans
TCONS_00142538 antisense novel protein coding TCONS_00118188 636 301 UTR3 Trans
TCONS_00143295 nucleoporin 35kDa novel protein coding TCONS_00118188 652 303 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding TCONS_00118188 604 286 UTR3 Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding TCONS_00118188 625 285 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding TCONS_00118188 625 285 UTR3 Trans
TCONS_00163367 runt-related transcription factor 1 novel protein coding TCONS_00118188 616 303 UTR3 Trans
TCONS_00174508 calcium-sensing receptor novel protein coding TCONS_00118188 617 297 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding TCONS_00118188 630 302 UTR3 Trans
TCONS_00195828 LRP2 binding protein novel protein coding TCONS_00118188 634 286 UTR5 Trans
TCONS_00210636 polymerase (DNA directed), eta novel noncoding TCONS_00118188 609 279 noncoding Trans
TCONS_00216783 KH homology domain containing 1 novel noncoding TCONS_00118188 674 317 noncoding Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding TCONS_00118188 668 302 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding TCONS_00118188 668 302 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding TCONS_00118188 668 302 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding TCONS_00118188 664 304 UTR3 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding TCONS_00118188 667 294 UTR3 Trans

Sequence

>TCONS_00249683 (2725 nt)
AGGGGACGCGCGGCGCGCTCCTCACCGGGCCCGGGCCCAGCGCCTATCGCCGCCCACGCGAGCCTCACGAATCCAGGAATGCGGAACCCGAGGATACTGA
GGGCCACTGTACATTGCAAAAAAATGGGACAAAAGACTTAGTGGAAAGGGTATAAAAGCTGATGAAGCAGAGCCTGAGGATTTTGTGGTGGAAAAAGTAC
TACACCAAGGTGTGGTGAATGGGAAGGTGGAATATTCCCTGAAGCGGAAAGGATTTACACTTGCTGACAATAATTGAGAACCTGAAGAAAACTTAGATTT
TCCTGAGTTCATTGAACTATTTCTTAATCCTCAAAAAAACTGGTAAAGGAAAAGATAGTACAAAAAGAAAATCTTTATCCGAGAGTGAATCTGATGACAG
CAAATGAAAGGGATGCTGCTGAAAAACCAGGAGACTTTGCCAGAACTCTTGATCCTAAGCAAAGAATTGGTGCCACAGACTGCAGTGAAGAATTAATGTT
TCTAATGGAATGCAAAGACTCAGACGAGGCTGACTTGGTGCTGGCAAAGAGGCAAACGCAAAGGGGCAAACACGAAGTGTCCTCAAATTGCAAATTATTT
TTATGAAGAGAGACTAACTTGGCATTCCTGTCCAGAAAATGAAACTCAAAAATTGTTGCACTGCAGTATACTGCCATATAGTGTGTGTGTGTGTAAAACC
TAGGTCTTGATTTTCTTATTAGTGTGAAATACTCTATTTTTAAAAAAATAGAGATAGAGTCTCACTATGTTGCCCAGGTTGGTCTCAAACTCTGGGCTCA
AGTGATCCTCCTGCCTTGGCTTCCCAAAAGTGCTGGGACTACAGACGTGAGCCACCCTGCCTGGCCAGCTATTTTCTAATGAAATCTATTTTCTACTGCA
AAATCTTGTTTTGAAGTAGAATCAAAAGAGTTTTTGGGGTTTGTTTGTTTTGGGTATTTGTTGGGGTTTTTTTCATCAATAGCACTTGTTACTTTTGAAC
AAGTAGGAAAAGCTTTCTGTAGCTGCTTCATTTACCAGAAAAGAATATTTGGTTCCATGGTATATTATTTCCTCTTTTCTAAATGTTGGGAACATTTTCC
ATAATCATTACTCAATCATAACTTGTGTTTAACCTATAATGCCTAAGGCTATTCTGAATTTTTGTTTGTTTGTGCATATGTAAATATACATGTACATAGT
TGTGGTTTTGTTTTTTATTTTACATGAACTAAGAAATAGCATTTCACAATCATGGGTAAATTCAAGTTTTCTTCTGGAATGCCATCGTTCTAAGCAGCCC
AAAGAATAGATCATCTTAAGTTAAAATTTTACCTAAAGCCACAATGTTTCAAATTGAATAATTTGTAATTAGTTGGCCAAGTTAAATACAATGTAAACAA
TTTAAATTGGACAATTTAAAGAAGCCAAATCAGAGCCGGGCACGGCGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCAGGCGGGCGGATCACCTGA
GGTTGGGAGTTCAAGACTAGCCTGACCAACATGGAGAAACCCCATCTCCACTAAAAATACAAAATTAGCTGGGCATGGTGGTGCATGCCTGTAATCTTAG
CTACTTGGGAGGCTGAGGCAGGAAAATCACTTGAACCCAGGAGGCGGAGGTTGTGGTGAGCTGAGATTGCACCATTGCACTCCAGCCTGGGCAATAAGAG
CAAAACTCCGTCTCAAAAAAAAAAAAAAAAAAAAGCCAGGTCAGAGTCCATAATGTCTATAGCTATAGTCATATAAAAGCAACAGTTTATTTGCAAAACC
TTCTAAAAGGAGAAATTTTATCACCAACAACCTCTGCACTCAGATGAGGAAACCAGACAGATACTGATGTGGCTTTTTTTTTTTTTTTTTGAGACAGGGT
CTTGTTATGTTGCCAAGGACGGTGTGCAGTGGTACAATTATAGCTAACTGCAGCCTTGAACTCCTGGGTTCAAGCAATCCTTCCGCCTCAGCCTCGCAAG
TAGCTAGGACTACAGACATATGCCACCACACCCAGCTAATTTTAAAATTTCTTTGTAGAGACAGGGTCTTGCTTTCTTTTCCAAGCTGCTCTAACTCTTG
GCCTTGAGCGATCCTTCCACCTCAGCCTCCCAAAGTGCTGGGATTGCAGACATAAACCACCACTCTCAGCCCAATACTGGTGTGTTTTAATTAGCCAAGC
AAGGCTTAGCTAAGTGGGCATTTAAAGGTTCCTTCTAAAGAGCCATTTCTTTACAAAAAGTTGAAAATCTTATGCTATATTGGCCAAAAGGTCATAATTC
ATGGAATGTCTTTGCTCATGAAACTAAATAGATGGTTAGAGATGTTGCTGTTTGAGACCTGGTGGCATACATGGGTGAACAATTGCAATGTAAACTCTTG
ACTTGCATGCTTTTTCTTTACCTCAACCCATTCATTACATGTAGGCTCAATCATTTCACTATTTAGGTTACTGGTTCAGAAGAAGCCAGGAAAAACAATA
ACACTATAGTAATAAGAATGTTGTTACCTGAGTGTGTATTGCTTACTTTCTTGCAGATACTGCTGAATGGCGATCAATACGTAGCTTTATATTTTTAAAA
ATAAAAATAACTTAGTGGCTTAAAGAGGAATCATTTATTTGCTTGTGATCGACAATTTGGGCTAAGCTCAGCTGAAGAGATCTTCTGCTGGTCTCACTTG
AGATCACTTCAACAGCTGCAATCACC

Expression



Full and truncated open reading frames discovered in TCONS_00249683

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.