Detailed information on TCONS_00177955

lncRNA-RNA interactions

Number of interactions: 204

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000261653 syntaxin 2 protein coding TCONS_00177955 536 296 UTR3 Trans
ENST00000262031 RNA binding motif, single stranded interacting protein 2 protein coding TCONS_00177955 570 308 UTR3 Trans
ENST00000262134 lysophosphatidylcholine acyltransferase 2 protein coding TCONS_00177955 523 307 UTR3 Trans
ENST00000262461 solute carrier family 12 (sodium/potassium/chloride transporter), member 2 protein coding TCONS_00177955 590 309 UTR3 Trans
ENST00000263955 serine/threonine kinase 17b protein coding TCONS_00177955 606 303 UTR3 Trans
ENST00000264914 arylsulfatase B protein coding TCONS_00177955 542 303 UTR3 Trans
ENST00000316077 MAP7 domain containing 3 protein coding TCONS_00177955 519 319 UTR3 Trans
ENST00000327381 XK, Kell blood group complex subunit-related family, member 4 protein coding TCONS_00177955 684 311 UTR3 Trans
ENST00000336824 fibronectin type III domain containing 3B protein coding TCONS_00177955 623 298 UTR3 Trans
ENST00000338758 parvin, beta protein coding TCONS_00177955 606 312 UTR3 Trans
ENST00000357491 zinc finger protein 43 protein coding TCONS_00177955 641 294 UTR3 Trans
ENST00000361228 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 protein coding TCONS_00177955 704 300 UTR3 Trans
ENST00000371065 leptin receptor overlapping transcript protein coding TCONS_00177955 732 313 UTR3 Trans
ENST00000375120 OTU deubiquitinase 3 protein coding TCONS_00177955 630 303 UTR3 Trans
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding TCONS_00177955 646 307 UTR3 Trans
ENST00000392373 syntaxin 2 protein coding TCONS_00177955 536 296 UTR3 Trans
ENST00000394622 STEAP family member 2, metalloreductase protein coding TCONS_00177955 719 306 UTR3 Trans
ENST00000395684 serine hydroxymethyltransferase 1 (soluble) retained intron TCONS_00177955 649 298 noncoding Trans
ENST00000395811 myosin phosphatase Rho interacting protein protein coding TCONS_00177955 721 301 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript TCONS_00177955 650 279 noncoding Trans
ENST00000397755 zinc finger family member 788 processed transcript TCONS_00177955 685 315 noncoding Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding TCONS_00177955 646 307 UTR3 Trans
ENST00000448612 WD repeat domain 27 protein coding TCONS_00177955 613 313 CDS Trans
ENST00000450928 antisense antisense TCONS_00177955 534 305 noncoding Trans
ENST00000467462 inter-alpha-trypsin inhibitor heavy chain family, member 4 processed transcript TCONS_00177955 660 300 noncoding Trans
ENST00000470361 potassium large conductance calcium-activated channel, subfamily M, beta member 2 processed transcript TCONS_00177955 622 301 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay TCONS_00177955 623 305 CDS_UTR Trans
ENST00000517408 antisense antisense TCONS_00177955 614 307 noncoding Trans
ENST00000521027 pleckstrin and Sec7 domain containing 3 protein coding TCONS_00177955 504 307 CDS_UTR Trans
ENST00000553936 gephyrin nonsense mediated decay TCONS_00177955 735 312 CDS_UTR Trans
ENST00000569455 cadherin 13 processed transcript TCONS_00177955 719 308 noncoding Trans
ENST00000594012 zinc finger protein 43 protein coding TCONS_00177955 641 294 UTR3 Trans
ENST00000604000 Lix1 homolog (chicken) like protein coding TCONS_00177955 766 295 UTR3 Trans
TCONS_00001594 lincRNA novel protein coding TCONS_00177955 703 306 UTR3 Trans
TCONS_00001594 lincRNA novel protein coding TCONS_00177955 689 294 UTR5 Trans
TCONS_00005323 polypyrimidine tract binding protein 2 novel protein coding TCONS_00177955 635 308 UTR3 Trans
TCONS_00005324 polypyrimidine tract binding protein 2 novel protein coding TCONS_00177955 635 308 UTR3 Trans
TCONS_00006081 processed_pseudogene novel protein coding TCONS_00177955 715 310 UTR5 Trans
TCONS_00007944 kin of IRRE like (Drosophila) novel protein coding TCONS_00177955 645 302 UTR3 Trans
TCONS_00008112 nicastrin novel protein coding TCONS_00177955 731 318 UTR3 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding TCONS_00177955 622 279 UTR3 Trans
TCONS_00014134 collagen, type XVI, alpha 1 novel protein coding TCONS_00177955 542 303 UTR3 Trans
TCONS_00025805 zinc finger, MIZ-type containing 1 novel protein coding TCONS_00177955 672 302 UTR3 Trans
TCONS_00033132 dynein heavy chain domain 1 novel protein coding TCONS_00177955 773 307 UTR5 Trans
TCONS_00033132 dynein heavy chain domain 1 novel protein coding TCONS_00177955 606 265 UTR5 Trans
TCONS_00034643 CD82 molecule novel protein coding TCONS_00177955 733 294 UTR3 Trans
TCONS_00038233 protease, serine, 23 novel protein coding TCONS_00177955 682 292 UTR3 Trans
TCONS_00051899 RNA binding motif, single stranded interacting protein 2 novel protein coding TCONS_00177955 570 308 UTR3 Trans
TCONS_00056597 C-type lectin domain family 7, member A novel protein coding TCONS_00177955 660 303 UTR3 Trans
TCONS_00058750 lincRNA novel protein coding TCONS_00177955 607 312 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding TCONS_00177955 684 304 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding TCONS_00177955 613 317 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding TCONS_00177955 684 304 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding TCONS_00177955 613 317 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding TCONS_00177955 613 317 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding TCONS_00177955 689 322 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding TCONS_00177955 719 304 UTR5 Trans
TCONS_00074894 lincRNA novel protein coding TCONS_00177955 607 306 UTR3 Trans
TCONS_00075339 latent transforming growth factor beta binding protein 2 novel protein coding TCONS_00177955 524 309 UTR3 Trans
TCONS_00075813 forkhead box N3 novel protein coding TCONS_00177955 610 311 UTR5 Trans
TCONS_00075813 forkhead box N3 novel protein coding TCONS_00177955 644 302 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding TCONS_00177955 610 311 UTR3 Trans
TCONS_00075827 forkhead box N3 novel protein coding TCONS_00177955 644 302 UTR3 Trans
TCONS_00075840 forkhead box N3 novel protein coding TCONS_00177955 683 319 UTR3 Trans
TCONS_00075841 forkhead box N3 novel protein coding TCONS_00177955 683 319 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding TCONS_00177955 711 312 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding TCONS_00177955 671 307 UTR3 Trans
TCONS_00083866 RAB27A, member RAS oncogene family novel protein coding TCONS_00177955 639 312 UTR5 Trans
TCONS_00090805 lysophosphatidylcholine acyltransferase 2 novel protein coding TCONS_00177955 523 307 UTR3 Trans
TCONS_00090929 nucleoporin 93kDa novel protein coding TCONS_00177955 679 279 UTR3 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding TCONS_00177955 604 320 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding TCONS_00177955 669 299 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding TCONS_00177955 669 299 UTR5 Trans
TCONS_00104871 hepatic leukemia factor novel protein coding TCONS_00177955 663 302 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 623 309 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 756 302 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 614 300 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 720 303 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 614 300 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 720 303 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 623 309 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 756 302 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 669 301 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 614 300 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 720 303 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 685 301 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 623 309 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 614 300 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 720 303 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 756 302 UTR3 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 557 300 UTR3 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 614 300 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 720 303 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 623 309 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 756 302 UTR3 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 557 300 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 623 309 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 756 302 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 557 300 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 614 300 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 720 303 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 623 309 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 756 302 UTR3 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 557 300 UTR3 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 614 300 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding TCONS_00177955 720 303 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding TCONS_00177955 670 309 UTR3 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding TCONS_00177955 706 306 UTR3 Trans
TCONS_00116334 low density lipoprotein receptor class A domain containing 4 novel protein coding TCONS_00177955 674 300 UTR3 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding TCONS_00177955 643 267 UTR5 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding TCONS_00177955 641 294 UTR3 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding TCONS_00177955 603 305 UTR3 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding TCONS_00177955 684 325 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00177955 678 269 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00177955 678 269 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding TCONS_00177955 678 269 UTR5 Trans
TCONS_00142168 LY6/PLAUR domain containing 6B novel protein coding TCONS_00177955 569 311 UTR3 Trans
TCONS_00143293 nucleoporin 35kDa novel protein coding TCONS_00177955 639 305 UTR3 Trans
TCONS_00143298 nucleoporin 35kDa novel protein coding TCONS_00177955 639 305 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding TCONS_00177955 631 301 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding TCONS_00177955 608 300 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding TCONS_00177955 670 294 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding TCONS_00177955 670 294 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding TCONS_00177955 644 312 UTR3 Trans
TCONS_00147106 ATPase family, AAA domain containing 2B novel protein coding TCONS_00177955 670 294 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding TCONS_00177955 644 312 UTR3 Trans
TCONS_00147115 ATPase family, AAA domain containing 2B novel protein coding TCONS_00177955 644 312 UTR3 Trans
TCONS_00147745 lincRNA novel protein coding TCONS_00177955 631 271 UTR3 Trans
TCONS_00147826 CDC42 effector protein (Rho GTPase binding) 3 novel protein coding TCONS_00177955 519 258 UTR3 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding TCONS_00177955 681 318 UTR3 Trans
TCONS_00150689 ectodysplasin A receptor novel protein coding TCONS_00177955 743 310 UTR3 Trans
TCONS_00152107 cordon-bleu WH2 repeat protein-like 1 novel protein coding TCONS_00177955 673 304 UTR5 Trans
TCONS_00152126 cordon-bleu WH2 repeat protein-like 1 novel protein coding TCONS_00177955 673 304 UTR5 Trans
TCONS_00152127 cordon-bleu WH2 repeat protein-like 1 novel protein coding TCONS_00177955 673 304 UTR5 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding TCONS_00177955 606 303 UTR3 Trans
TCONS_00159938 zinc fingers and homeoboxes 3 novel protein coding TCONS_00177955 620 307 UTR3 Trans
TCONS_00159951 zinc fingers and homeoboxes 3 novel protein coding TCONS_00177955 743 299 UTR5 Trans
TCONS_00160920 protein tyrosine kinase 6 novel protein coding TCONS_00177955 704 304 UTR3 Trans
TCONS_00160924 protein tyrosine kinase 6 novel protein coding TCONS_00177955 704 304 UTR3 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding TCONS_00177955 802 315 UTR3 Trans
TCONS_00163348 runt-related transcription factor 1 novel protein coding TCONS_00177955 714 295 UTR3 Trans
TCONS_00163350 runt-related transcription factor 1 novel protein coding TCONS_00177955 714 295 UTR3 Trans
TCONS_00163352 runt-related transcription factor 1 novel protein coding TCONS_00177955 714 295 UTR3 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding TCONS_00177955 601 302 UTR5 Trans
TCONS_00168219 THO complex 5 novel protein coding TCONS_00177955 678 312 UTR3 Trans
TCONS_00168220 THO complex 5 novel protein coding TCONS_00177955 678 312 UTR3 Trans
TCONS_00168418 dual specificity phosphatase 18 novel protein coding TCONS_00177955 682 287 UTR5 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding TCONS_00177955 685 315 noncoding Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding TCONS_00177955 721 311 noncoding Trans
TCONS_00173891 RNA, U6 small nuclear 461, pseudogene novel protein coding TCONS_00177955 679 286 UTR3 Trans
TCONS_00175515 transient receptor potential cation channel, subfamily C, member 1 novel protein coding TCONS_00177955 717 310 UTR5 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding TCONS_00177955 695 306 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding TCONS_00177955 655 313 UTR5 Trans
TCONS_00187460 spermatogenesis associated 18 novel protein coding TCONS_00177955 698 306 UTR3 Trans
TCONS_00189916 doublecortin-like kinase 2 novel protein coding TCONS_00177955 562 301 UTR3 Trans
TCONS_00189917 doublecortin-like kinase 2 novel protein coding TCONS_00177955 562 301 UTR3 Trans
TCONS_00189925 doublecortin-like kinase 2 novel protein coding TCONS_00177955 562 301 UTR3 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding TCONS_00177955 742 293 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding TCONS_00177955 623 305 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding TCONS_00177955 623 305 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding TCONS_00177955 681 305 UTR5 Trans
TCONS_00195828 LRP2 binding protein novel protein coding TCONS_00177955 610 281 UTR5 Trans
TCONS_00196430 trio Rho guanine nucleotide exchange factor novel protein coding TCONS_00177955 726 316 UTR3 Trans
TCONS_00196432 trio Rho guanine nucleotide exchange factor novel protein coding TCONS_00177955 726 316 UTR3 Trans
TCONS_00199451 solute carrier family 12 (sodium/potassium/chloride transporter), member 2 novel protein coding TCONS_00177955 692 293 UTR3 Trans
TCONS_00203197 3-oxoacid CoA transferase 1 novel protein coding TCONS_00177955 625 303 UTR3 Trans
TCONS_00203198 3-oxoacid CoA transferase 1 novel protein coding TCONS_00177955 625 303 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding TCONS_00177955 686 314 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding TCONS_00177955 697 307 UTR5 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding TCONS_00177955 647 296 UTR5 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding TCONS_00177955 611 307 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding TCONS_00177955 697 307 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding TCONS_00177955 647 296 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding TCONS_00177955 611 307 UTR5 Trans
TCONS_00203988 family with sequence similarity 169, member A novel noncoding TCONS_00177955 611 307 noncoding Trans
TCONS_00204896 erythrocyte membrane protein band 4.1 like 4A novel protein coding TCONS_00177955 774 311 UTR3 Trans
TCONS_00212185 TEC novel protein coding TCONS_00177955 665 295 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding TCONS_00177955 611 294 UTR5 Trans
TCONS_00219475 WD repeat domain 27 novel protein coding TCONS_00177955 613 313 UTR3 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding TCONS_00177955 643 310 UTR5 Trans
TCONS_00235685 oxidation resistance 1 novel protein coding TCONS_00177955 770 315 UTR3 Trans
TCONS_00235698 oxidation resistance 1 novel protein coding TCONS_00177955 770 315 UTR3 Trans
TCONS_00235699 oxidation resistance 1 novel protein coding TCONS_00177955 770 315 UTR3 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding TCONS_00177955 734 307 UTR3 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding TCONS_00177955 770 315 UTR3 Trans
TCONS_00238831 cytochrome P450, family 7, subfamily B, polypeptide 1 novel protein coding TCONS_00177955 518 295 UTR3 Trans
TCONS_00240045 zinc finger protein 706 novel protein coding TCONS_00177955 712 310 UTR3 Trans
TCONS_00240046 zinc finger protein 706 novel protein coding TCONS_00177955 712 310 UTR5 Trans
TCONS_00243475 osteoclast stimulating factor 1 novel protein coding TCONS_00177955 647 282 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding TCONS_00177955 722 294 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding TCONS_00177955 647 282 UTR3 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding TCONS_00177955 722 294 UTR5 Trans
TCONS_00244033 WNK lysine deficient protein kinase 2 novel protein coding TCONS_00177955 626 299 UTR5 Trans
TCONS_00244038 WNK lysine deficient protein kinase 2 novel protein coding TCONS_00177955 626 299 UTR5 Trans
TCONS_00244055 WNK lysine deficient protein kinase 2 novel protein coding TCONS_00177955 626 299 UTR3 Trans
TCONS_00244067 WNK lysine deficient protein kinase 2 novel protein coding TCONS_00177955 626 299 UTR5 Trans
TCONS_00245543 long intergenic non-protein coding RNA 963 novel protein coding TCONS_00177955 648 271 UTR3 Trans
TCONS_00247562 contactin associated protein-like 3 novel protein coding TCONS_00177955 656 311 UTR3 Trans
TCONS_00249090 transmembrane protein 245 novel protein coding TCONS_00177955 673 306 UTR3 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding TCONS_00177955 616 285 UTR5 Trans
TCONS_00249285 zinc finger protein 883 novel protein coding TCONS_00177955 813 316 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding TCONS_00177955 605 313 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding TCONS_00177955 692 297 UTR5 Trans
TCONS_00253258 sushi-repeat containing protein, X-linked 2 novel protein coding TCONS_00177955 543 313 UTR3 Trans

Sequence

>TCONS_00253258 (8032 nt)
AGCAGTGGGGGAGAGCTCAGCCAGCCCTGCAGGGCGAGCAGTCCAGCCTTGTGTTCACCGGAGCTTAAGCGTTGCAGCAGGAAAACTTCCATCTCGCTCT
CCTGGCTTTGATCCTCACTGGACATCAGACCAGAGGCACCGAAGGGAGGGAGGATGCGAGATGACCGGCCCTTTGGCAACCTGACCATCGACTTAGCAGA
GCCTTCAAAAGCAAGCCAGGGGCTGGCTGCACGACCAAAGAGGCGCCGCGCCTCTCGTGGATGTGTGTGTGTGAGTGATCCAGCGAGTGTGTGTGCGTGT
GAGGGTGTGTGTGTGTATGCCTGTGTGCACAGCACAACTGTGTGCGTGTCCCGGTGAGTGTGCCTGTGCATGCGTGAGTGTGTGTACGTGTGCATGTGTG
TGTGAGTGCGCTTGGTTATTACTATTATTATTATTTTTGGAAGAAAAATCTTTGAAAATCTGGGGCAGGTTACTGTGCTCCTAGGGTGATTCTTCTTTTG
CAAGAGGAGCTGACCAGGGCAAGCTACTAGAGCCATTTCTCGGCAAGTAAAGAGATTTTTCCTTCCAGAAGGAGAAGGATTTTTCTCCCTGCTCTGCAGC
CAAGTGAAAGAGATTAGTCCCTAAACCTGTGAAATCGACCAGAGCTGTGTGATTACCAGGGCTTGAGAGAGGACTCGAAAAGAAAAGGAGAAATAAATCA
AACAGCCTGTCAGTTCCTTTGGCCACGTCAGAAGATGTCATCTCAAACTAAGTTCAAGAAAGACAAAGAGATCATTGCTGAATATGAAGCCCAAATAAAA
GGGAGAGCTGGAGAAACTCTTATAGAAGAAGGATCTTTTAAGCAGGATTTTGAAGGATGAATAGAAGCTCTCCAGGTGGTGAAAGGCATTACCTGAAGAG
AAGACAGCATGTGCAAAGGTATGGGGGTCACAAAAGGGTCAGGGTACTTGAGAAATGGTGAGGAGTTTGAGGTGGCTAAAATCCTGAGTAGGTGGAACAA
AATGGTGGTGGGAGATGAGGCTGGAAAGGAGAAGAGCTTGAAGTTCCTGTCTGATCATCAGATCCTGTAAGTCTTTGACCTTGAAGATGGTATGGATGAG
AGTCGTATTTATTTGTTGTGGTAAAATACACAAACACAAAGTTTACCGTCTTACCCATTTTTAATTGTGCAGCTTAGTGGTATTAAATGCATTCACATTA
AATGCCACCCATCTTCATAACTTTTTTCATCTTGTGAAATGCAACTCTGTACCCATTAAACAATAGCTCCTTGGCCGGGCGCGGTGGCTCGTGCTTGTAA
TCCCAGCACTTTGGGAGGCTGAGGCGGGCAGATCACGGGGTCAGGAGATCGAGACCATCCTGGCTAACACGGTGAAACACTGTCTCTACTGAAAATACAA
AAAAATTAGCCAGCTGCAGTGGCGGGCGCCTGTAGTCCCAGCTAATCGGGAGGCTGAGGCAGGAGAATGGCGTGAATCCGGCAGGTGGAGCTTGCAGTGA
GCCGAGATCATGCCACTGCACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTCAAAAAAAAAAAAAAAAAAGAAAAAGAAAAAAAATAGCTACTCGTTT
CCTCCTCGTTCCCAACCCCTGGCAGCCACCATGCTACTCTTTGTGTGAATTTGACTCCTTTAAGGAAAATATAAGAATCTAGAAGCCCCTACCTGAAATA
ACCACTATAAACATTCAATGTATTTCCTTCCAGACTTCACGTCTCTATCAATCACATTTGTTTTATATCTGTGTATAATAAAAATGGGATCATAGATCTT
TAAGGCAGAGTTATAAAAATAAAGCTGATAGGAAAATAATCATAGGCCTATAGGCTGAGGACTTGAAATAGAGTATGGCCTAAAAATAAACAGTTTGTCA
AGTAAGAACATCAATATGCGTGACCTCCTACGTCCGTTTTAATGGTCCTTTAGGGAGGGGACACCACTCTCTTGTGGCGCCTGGCTTGTGTTGGTCACTT
CTGTCTCAGGTCTTTGTGATTTGGGTAAAACTGGGGGGAACTGAGCTAACTCATCAAGAACTTCCCTCACTGCCACATTTGTCCCAGCCACTTTCAGCTA
GAATTTCCCCCTTCCCATCCCTGACAGTCTTATTTCCCTGTTGGTCCTAGGCAGCAGTTTCTGTCTTTGGCAGCAAGTGCTAAAGGGAGAGGCTTGTCTA
GGGCAAAGGATTCATCTTCAGCAGCTGGAGACCCTCCCTGCTGGTACCTGTTCCCTGGTCTACCTTTCCTTTCCTCCTTGTTGCTCTCTGCTGGATTTCC
TGGCCATTGTGATACTTTTTGGATTCCGGATTGCTTGTCTGCTCCTGGCAGATGTAGCCTGCCATCCCCTTGCTTCCGATTGCTGGTGAGAGCATTTTCA
AAATACAGTTAATGTAGATCAGTAAGTTTTCCAACCATTTGTCAAATAGAAAGACCTGGATTTCTGTAGGCGGGTAGAGTTCTCGCTGAGAGATTCAAGC
TTGGCAGGATGAGACAGTTCCTTAGGGGACCTTCTATAGCTTATAGTGCCTTAAGAGGGTCAGAGAAATGACATGAGAAGACTCTTACCAATGAAACATC
TCAGCCACCTTCAGGGACACAAAAGAATGGATGTCATGTCTGTGATTTAATTTGTACTAAAGAATGTGAACTGGCCAAGCGACATGGCTGTTCTCCAACT
CAGTGTCTCGGTAGGACACTTCCAAGCAGAGTTGGCAGTCACAATGTCTTTACTTTGATCAGTGGCCTCTCCAGACAGGATGTTTTGGGTCTCCCAAAGA
TCTATTACCTTGGGGAAACTGAGGCAGAACAACAGTCACTCTCTGGCTTCTGACGTCTTATAGTTGATTACTCCTTGACCTCTTGCTCCGATCTTCTGGA
CCCTTGATCATTTGCCTGGTTGTGGTTGTTTGAATTTATTTGTCCCGTGACCCTCAGCTAATCTAGGGCTCCATCCTTGGCCTGATCCTCCAGGTTCAGG
CCCCACCCTGAGCATCTCTGTCTTGCTGGATCTCGTACTTGGCATAATATCACCATTGAAACTCTGCTCCAAAAATGGCAGAGGCTCTACTGCTGTCTGC
CAGAAACATAGAATTATGTTACTGGGAATTGTGTGAAAGAAATGCTGAGAATGTGGTGGGCCAGTTCACATAGATTTAGCTTAACAAATATTTATTGAGC
TCCTACTATGTTCCCTGCCCGCACAGACTTTATAATTCTGTGGGGAAGACAAAGGATAATTTGTAATTACAAAAGTGTTGAGTGTTATGGAAGGAGTGGT
GCAGTGTGCATGGGGGAATCTATAGCAAATGGATCTAAAGGGCTGAAAATGCTGTGGGTGATTTACTGATACTGATTTGTAAAGCTGAGTTGTATTGACT
AAGCTTACCTCACCATCATTGTTTCCTGAGCTCTTTAGGATCTAGACAGAACCATCTTTCCATTTAGAGAAGGGTCAGAAGTCATCAAAATATTTAAGGG
GTCAGAAAGATCAGTGCTTCTAAGAGAAACACACAACTCCAGGTGTAAAAGATAAAAGTGGTTCCAGAAAGGGGATTTTATAATAGCTCTATTCAGGATG
GTAAATACCATCGTGGGATGAGTGCTTTTAAGGTGAAATTAAAGCCAGGAATCAGCTGAAGAAGATTGAAACCCACCTTCTCTTGATAGAATTAAGCTAA
AGTCACAGAGATAGATGAGACAAGAAAGTGGAATGTAACGTGGAAGGAGGCAGCTGTGATGCCCTGGGTGGAGTCACCCAGACCGGGGTTCAATCACGGC
TCATGGTGAATCAGCTGAATGACCTTGGATGAAAGTCATTAACTTTTCTGAGTTCCAGTTTCCTCATGTGAAAGAGGGACATAATAACACCTCACTGTGT
GTGTGGGTAATTAATTGAAATAACATAAGTCAGAATTTCCAGCACAGTGCTTGGCACACAGTAGCATTAATTAAACACTAGAAATGTCGGCTAAGCCAGT
AAGTGGGGCACCAGCATTCAGAGTCCTGGACAGTGATTCTGAACCAACAGCTGAAGCCATTAGTAAGTGCACCTGGTTGGGAAGGAGAGTAAGGTGGGGC
AGTACTAAAAGACATCAGGAGACGTGGAGTTGGCAGCATGGGTAGCTGGGAAAAGAAAATACTAGTAAGTTGTAGACAGGCATGACACTTTCTTTGCCTG
TTATGTGTGTGTTTCTCCCAGTGTGGTTCCTGGACCACCTGCAGCAGAATCACCTTGGAGGAACTTGTAACAAATTCAAGGAACTTGAATTCTAGGAACC
ACCCCAGACCTACTGAATCAGAATCTCTGTTGGGGGGCAGTGGGTGGACCCTGGGAATCTGCATTTTACAAGTGCCTCAGATTTCATGAACTTAACATAA
TTGGCCCTGGTCTATAGTAAACTCACCAGTTTGGCTGTGTATCTTTTTTTTGAAAGCAAAAGAACATTTAATAATTAGGTAGACTATTGCTGAGTGAGGT
GGGAAAAATAACACCCAAAGTGTGTGTGTGTATGTGTGTCTGTGTGTGTATGTATTACAGTTTTAAAAATAAAAACCCTATGTCCTTATATATTTAGATA
TGTATAAAAAGAGTCTTTGGTTTTTGACGATTGGTAATGAGGTTTACCCTTGGGGACGAGGGGTGGAATAGGGTGGTAGTGTCAGGGGACAGGGGAAAGA
AGACCTTTTCATCTTTATACTGTTCAATTTTGATTGGCTTCTGAAAAAAATGAGCATGTATTCCTTTTCTGATTTAAAATTCCACGAAGTTGACAGTAAG
TAAGGACTTTGTTGGCAAAATTCCTGCTAGAGAGGATGCTCAGACATCAGCTGAACTGTAAAAGAAAGAAAGTGACACCTGCAAGAGCTATTTAAATTAT
GCTGAACTTACTGTGGTGCTCATTATGTAGTGTAAGGATGATTGCTGAAATGAAACGTAATATTTTACCGAATTATTCCCCCACGCAGTGAGGAAGTTTT
TCCATACTCTTTCAAAACTTTGAAATATGGGTAGAAGAGTGGAAAAGTTCAGCTTAACCTTTTAATTTACCGAGTTTCAGTCAGGAGCCATCGTGATGCA
GTGGCCAGAGTCTGGGGTTTAGACTCATAAGACCCGATTTTCCATCTCTGGTCTGTCTTTTGAGCGAGTCACGTCTGCATTCTTCATTCTGCATCTTGGC
TTCCTCATCTGTGAAATGAGGGCATTATCAACCTTAAAGGGTGGTTGCTGTGAGGATCAAATGAGGTGGTGTGTGAGAAAGTAAACTCTCGAGTGCTGCG
GAAATGTTCATTATTTCTATTTTTTGTCCCACTCCTACCCTGGACATGCTGCTATTACAGTGGGGTTGTTTATGTGTCTGTCCCTCTGTGAGCTCATTGA
GTGCAGAAGCCTTGTTTTATTCATTCCCGAATTCTTGTGCTTAGGGCCTGCCACACAGGAGGCATTCAAAGCAACTTCTGGAATAGCTATCAAGGAGAGA
AAAATACACACACAGTTCGGTGTTGGCCTATAAAAATATTAAGATAGTCTTCCAGAAAACATTATCTTCCATTTCTATTTAAAGGAATTAAAAAACATTT
ATCCAAATCCACAACAGAAATTATATTGCTAGGAGAAAATAAAGAACTTCATTAAAGAAAATTTAATTGCCCAGTTTTCTAAAGAGACAGAACCGCATCC
TTCCATCCTCATTACTGCCAAATGGGTGACGGCCGTTTCCAAGGGAGGCAAGATGAATGACAAGGGATTGTGAGAAGGCAAATCCTGATACTCTAGGAGA
AAAGTCTCCCAAGAAACGGGAATGCCCCCCCAGATCACCAGTTACACTATTGTTTGTCAGAGCTGTGGAAGAAGCCTTCTCTGAGCTCCTTGGACAAAAG
CCCTTTTTGGCTTCCACCCCAGACCTTGGCCGATAAACCACAAAGTCCCTATTTCCCCTGGAAGTGGGAAAACTTCCAGTGGCTCGACAAAGCTGGAAGG
ATTATCTGAGATTCAATTTGGGGGCTGTGGTACCTCCAAGACCCTGATAATTATCATCTGAATGGGCAGGGGGAGGATTGAAGCCAAATCTAGTAACAGA
GCCCTGGGGTAGACCTGCAGTTAGAAGACAGGGGACCGATCTCAGCTTTGGCCCCTTTTCATGTCCTGCTACGAGTCTGCTCTTTTTTCTTTTCTTTTCT
TTTCTTTTTTTTTTTTTTTGAGATAGGGTCTTACTCAGGCTGGAATGCAGTGGCGCCATCATAACTCACCGCAGCCTTGAACTGCTTAAGCAATCCTGCC
TCAGACTCCTGCGTAGCTGGGACTATAGGTGCATGCCACCATGCCTGGCTAATTTTAAAAAAAAATTTTGTAGAGACAGCGTCTTGCTATTTTGCCCAGG
CTATCTTAAACTCCTAGGCACAAGCGATCCTCCTGCCTTATCCTTCCAAAGTGCTGCGATTCCAGGCATGAGCCACTGTGCCTGCCCAAATCCATGCTTT
CTTTTTCCCTCTCCCACACCAGTTCCCAAGCACAGACCAATCAGGTAGCACCATTAGATGAGTTCATAACTGTTTGAAGATGTGATTCTGGCATGGGGGT
ACGATTGTCATCCTAGGTGAAGTCTCCAGTGGCATGCCAAAAGGCTGTCTCCTGTTCAGTGTTTTAATTACCTGGATGAGGATGTGAGCATGCCCATCCA
GTTTGAGAATGTCAGGAAACCAAGGAAGGCAGGCTTAGTAATTGGGAACACAGTTGTTGGTATTGAACTGACCAGGGTTTGCAACCTTTTAGCCACTTTC
TAGCCGTGTGACTTTGGGCAAGTGTTTTCATCTCTTTGAGCCTCACTGTCATCATCTGTAATAATAATAATCCAACCTCAAACAGTTATTGAGCCAGTTA
GATGAGATAATGTGTGTAAAACCCTTAGCACAGTGCCTGGCACTCAGTCAGCGTCACCGATTGTTATTAATAAATCACAACTGTAAGAGCCGCGCTGCAG
GCTCTGGAGTCTGGGTTTAAATTCTAGTGCTGTCAGTGAATGAGTTGCTTAACTTCTCTGAGGCTCAGCTTCTTCCTCTGTAAAATAAGGACAGTAATAC
TTACCTTGGGAGTTGCTGTAAATAAAGCATTCAGGCCAGAATAGACACATAGCAGATACTCAATAAACCGAGGTTACCATTCAGAGAAACAGCGAATCCT
GTGGCAGAGAGAACCAGGAAGCAGAGCGCTTAGCAGGAGGGGATGAGGAATTGACTCTAAAAATGCGAAGTTTAATAGTATCTTTAAGAGAAAAACCACC
CACTCATTGAAAGAAGCTACATTGTTTTGGATCTTGAGCCCTGAGAAGAATTTATCCTATAAATAGATAGAAATATGAATGGGGTAGGGACCAACTGGCA
TTTGGTTAGGATGCCAGACCTCAGGCCCTGACCCCATCCTGTCCCTTGTCCAGTGGCTTTTGGCCCCTCCCCAAGAGATTCTAGCGAGATATGTGTGACA
CAGGCCGCTGGCTAGGAAATGAAATCTTATCTCAAAGCTGTGGCTGAACACAGAATTCTGGTGAGCTGTTCTCCACGTGGAGAACGCCTTTGGCCTAGGG
AGGTTGCCATGCCGGCCTCTGTCCGGGCCCACACCTGAATCTCAGCTCTATTGCTCCAGGGTAGAGGAAGCTGATCTGGAGTGGGTCAGCCTTGGGGGAC
AGCTGGAGTATCTGACCCCTTTCCTATAGGGACCAGCTAGACGACTGCTCCTGCTTCTCTCCCAGATGTGACCAGGCCTACCTAGCCACAGAAAGAAGAA
TGTCAAAAGTCTGGACCCACCCAGACTGAACCTTTGAGCTTCTTAGAAGTGCAATGTCTGGGAATTTTGGTTCATGACTGTATCGTAGAACCTAGCTAGT
CCATAATATCACCTTTCCTTCCAGTGGGTGGACTACTATGCCCTTAATAATAACCCTGATTTGGGGAGGAGTAAGTAGAGTTGACTTTTTTTTTTTTTTT
TTTTTTTGAGACGGAGTCTCGCTCTGTCGCCCA

Expression



Full and truncated open reading frames discovered in TCONS_00253258

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.