Detailed information on TCONS_00212429

lncRNA-RNA interactions

Number of interactions: 2

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
TCONS_00138868 WD repeat containing planar cell polarit... novel protein coding TCONS_00212429 917 387 UTR3 Trans
TCONS_00138868 WD repeat containing planar cell polarit... novel protein coding TCONS_00212429 856 365 UTR3 Trans

Sequence

>TCONS_00212429 (387 nt)
CCTAGGTTTTCTTCTAGGGTTTTTATGGTTTTAGGTCTAACGTTTAAATCTTTAATCCATCTTGAATTGATTTTTGTATAAGGTGTAAGGAAGGGATCCA<br />GTTTCAGCTTTCTACATATGGCTAGCCAGTTTTCCCAGCACCATTTATTAAATAGGGAATCCTTTCCCCATTGCTTGTTTTTCTCAGGTTTGTCAAAGAT<br />CAGATAGTTGTAGATATGCGACTTTATTTCTGAGGGCTCTGTTCTGTTCCATTGATCTATATCTCTGTTTTGGTACCAGTACCATGCTGTTTTGGTTACT<br />GTAGCCTTGTAGTATAGTTTGAAGTCAGGTAGCGTGATGCCTCCAGCTTTGTTCTTTTGGCTTAGGATTGACTTGGCGATGCGGGCT

Expression



Full and truncated open reading frames discovered in TCONS_00212429

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

Best hit to NONCODE v4:
NONHSAT016690 (Evalue: 4.0E-180)

Best hit to Swiss-Prot:
sp|O00370|LORF2_HUMAN (Evalue: 1.0E-83)