Parental gene: | TIMM9, ENSETEG00000014123 |
| Aliases: | None |
| Description: | translocase of inner mitochondrial membrane 9 homolog (yeast) [Source:HGNC Symbol;Acc:11819] |
| Organism: | Lesser hedgehog tenrec (Echinops telfairi) |
| Coordinates: | GeneScaffold_1348:1022..4254(-) |
>ENSETEG00000014123
ATGGCTGCGCAAATACCAGAATCCGATCAGATAAAACAGTTTAAGGAATTTCTTGGAACCTACAATAAAGTTACAGAAAC
CTGCTTTTTGGACTGTGTTAAAGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCACGTGTTCAGAGCATTGCTTAC
AGAAATATTTAAAAATGACACAAAGAATATCCATGAGATTTCAGGAATATCATATTCAGCAGAATGAAGCTCTAGCAGCC
AAAGCAGGACTCCTTGGCCAACCCCGCTAG
| Species | Parental gene accession | Homology type | Retrogenes number | |
|---|---|---|---|---|
| Ailuropoda melanoleuca | ENSAMEG00000002589 | ortholog_one2one | 1 retrogene | |
| Bos taurus | ENSBTAG00000010503 | ortholog_one2one | 2 retrogenes | |
| Cavia porcellus | ENSCPOG00000020422 | ortholog_one2one | 5 retrogenes | |
| Dasypus novemcinctus | ENSDNOG00000014822 | ortholog_one2one | 4 retrogenes | |
| Dipodomys ordii | ENSDORG00000002185 | ortholog_one2one | 2 retrogenes | |
| Equus caballus | ENSECAG00000017063 | ortholog_one2one | 1 retrogene | |
| Felis catus | ENSFCAG00000010833 | ortholog_one2one | 2 retrogenes | |
| Homo sapiens | ENSG00000100575 | ortholog_one2one | 2 retrogenes | |
| Loxodonta africana | ENSLAFG00000008658 | ortholog_one2many | 1 retrogene | |
| Macropus eugenii | ENSMEUG00000003698 | ortholog_one2one | 2 retrogenes | |
| Microcebus murinus | ENSMICG00000011791 | ortholog_one2one | 3 retrogenes | |
| Monodelphis domestica | ENSMODG00000007898 | ortholog_one2one | 2 retrogenes | |
| Nomascus leucogenys | ENSNLEG00000013292 | ortholog_one2one | 2 retrogenes | |
| Otolemur garnettii | ENSOGAG00000002472 | ortholog_one2many | 2 retrogenes | |
| Ochotona princeps | ENSOPRG00000002924 | ortholog_one2one | 1 retrogene | |
| Procavia capensis | ENSPCAG00000003568 | ortholog_one2one | 1 retrogene | |
| Pongo abelii | ENSPPYG00000005859 | ortholog_one2one | 2 retrogenes | |
| Pan troglodytes | ENSPTRG00000006394 | ortholog_one2one | 2 retrogenes | |
| Sorex araneus | ENSSARG00000012165 | ortholog_one2one | 1 retrogene | |
| Sus scrofa | ENSSSCG00000027270 | ortholog_one2one | 2 retrogenes | |
| Tarsius syrichta | ENSTSYG00000000502 | ortholog_one2one | 5 retrogenes | |
| Tursiops truncatus | ENSTTRG00000008743 | ortholog_one2one | 1 retrogene |
| # | RetrogeneDB ID | Identity (%) | Coverage (%) | ORF conservation | Expression evidence | RDV |
|---|---|---|---|---|---|---|
| 1. | retro_etel_760 | 62.50 | 98.88 | Please wait, loading  |
Please wait, loading |
Please wait, loading |
| 2. | retro_etel_778 | 81.82 | 86.52 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 3. | retro_etel_1494 | 81.32 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 4. | retro_etel_1551 | 78.89 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 5. | retro_etel_1603 | 80.90 | 98.88 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 6. | retro_etel_1986 | 69.12 | 75.28 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 7. | retro_etel_1994 | 56.67 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 8. | retro_etel_2201 | 75.28 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
Download FASTA sequences of all ENSETEG00000014123 retrocopies