RetrogeneDB ID:

retro_hsap_35

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:9:71395080..71395944(+)
Located in intron of:ENSG00000107242
Retrocopy
information
Ensembl ID:ENSG00000187866
Aliases:FAM122A, C9orf42
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:FAM122C
Ensembl ID:ENSG00000156500
Aliases:None
Description:family with sequence similarity 122C [Source:HGNC Symbol;Acc:25202]


Retrocopy-Parental alignment summary:






>retro_hsap_35
ATGGCTCAGGAGAAGATGGAGCTAGACCTGGAGCTGCCTCCGGGTACGGGCGGGAGCCCGGCGGAGGGCGGTGGCAGCGG
CGGCGGCGGGGGCCTCAGGAGGTCTAACAGCGCCCCCCTGATCCACGGCCTCAGTGACACTTCGCCGGTGTTCCAGGCCG
AGGCGCCGAGCGCCAGGCGGAACAGCACAACGTTCCCGAGCCGCCACGGCCTGCTGCTGCCGGCCTCCCCTGTCCGCATG
CACAGCAGCCGCTTGCACCAGATCAAACAAGAAGAGGGCATGGACTTGATCAACCGAGAGACGGTCCACGAACGGGAGGT
GCAGACCGCAATGCAGATAAGCCACTCCTGGGAGGAAAGTTTCAGCCTGAGTGACAACGACGTGGAGAAATCCGCCTCCC
CCAAGCGCATCGATTTCATTCCTGTGTCACCAGCACCGTCACCCACTCGGGGAATTGGGAAGCAGTGTTTTTCGCCATCC
TTGCAAAGTTTTGTAAGTAGCAACGGATTGCCTCCAAGCCCTATTCCCAGCCCAACGACCCGATTTACCACCCGGAGAAG
CCAGAGCCCCATCAATTGCATTAGACCAAGTGTTCTTGGACCATTGAAAAGAAAATGTGAAATGGAAACTGAATATCAGC
CAAAGAGATTTTTCCAGGGCATCACCAACATGCTTTCTTCTGACGTTGCACAGCTGTCAGATCCTGGTGTGTGTGTATCT
TCGGATACCCTTGATGGAAACAGCAGCAGTGCCGGATCTTCTTGTAACTCACCAGCGAAAGTCAGCACTACCACCGACTC
TCCTGTGTCACCTGCCCAAGCGGCTTCTCCATTTATTCCACTAGATGAACTTTCGTCTAAGTGA

ORF - retro_hsap_35 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 58.47 %
Parental protein coverage: 98.38 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalMDLINRETMSEWKLQSEIQISHSWEEGLKLNDNGLQKSSSLKCIDLTPVSSMASSIKKTGKQCFSPSLQT
MDLINRET..E...Q...QISHSWEE...L.DN...KS.S.K.ID..PVS...S.....GKQCFSPSLQ.
RetrocopyMDLINRETVHEREVQTAMQISHSWEESFSLSDNDVEKSASPKRIDFIPVSPAPSPTRGIGKQCFSPSLQS
ParentalCVSCTGSPSSPIPSPMQQYIIR-SQNPTNIIRPSILGPLKRKGEMAFQYQPKKIFQGTTNMLSSDTSQLS
.VS..G.P.SPIPSP......R.SQ.P.N.IRPS.LGPLKRK.EM...YQPK..FQG.TNMLSSD..QLS
RetrocopyFVSSNGLPPSPIPSPTTRFTTRRSQSPINCIRPSVLGPLKRKCEMETEYQPKRFFQGITNMLSSDVAQLS
ParentalENNVYLLPATFDGNDSNAGSSGNSSAEIGTVTNSPVSPSDTGS
...V.....T.DGN.S.AGSS.NS.A...T.T.SPVSP....S
RetrocopyDPGVCVSSDTLDGNSSSAGSSCNSPAKVSTTTDSPVSPAQAAS

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 9 .20 RPM 4 .11 RPM
bodymap2_adrenal 9 .25 RPM 5 .12 RPM
bodymap2_brain 8 .58 RPM 3 .49 RPM
bodymap2_breast 8 .31 RPM 3 .23 RPM
bodymap2_colon 10 .71 RPM 2 .22 RPM
bodymap2_heart 8 .55 RPM 1 .81 RPM
bodymap2_kidney 5 .98 RPM 1 .78 RPM
bodymap2_liver 3 .30 RPM 0 .13 RPM
bodymap2_lung 3 .22 RPM 7 .35 RPM
bodymap2_lymph_node 7 .18 RPM 2 .14 RPM
bodymap2_ovary 8 .98 RPM 11 .51 RPM
bodymap2_prostate 9 .91 RPM 4 .35 RPM
bodymap2_skeletal_muscle 9 .95 RPM 0 .67 RPM
bodymap2_testis 9 .94 RPM 8 .96 RPM
bodymap2_thyroid 10 .87 RPM 3 .39 RPM
bodymap2_white_blood_cells 12 .62 RPM 3 .05 RPM
RNA Polymerase II activity may be related with retro_hsap_35 in 50 libraries
ENCODE library ID Target ChIP-Seq Peak coordinates
ENCFF002CFW POLR2A 9:71394695..71395189
ENCFF002CFX POLR2A 9:71394696..71395174
ENCFF002CGN POLR2A 9:71394786..71395138
ENCFF002CHO POLR2A 9:71394390..71395492
ENCFF002CIH POLR2A 9:71394615..71394928
ENCFF002CIO POLR2A 9:71394598..71395161
ENCFF002CJE POLR2A 9:71394593..71395026
ENCFF002CJZ POLR2A 9:71394624..71395153
ENCFF002CKX POLR2A 9:71394647..71395179
ENCFF002CLM POLR2A 9:71394656..71395196
ENCFF002CMI POLR2A 9:71394416..71395230
ENCFF002COJ POLR2A 9:71394785..71395221
ENCFF002CPG POLR2A 9:71394704..71394922
ENCFF002CPG POLR2A 9:71394761..71395251
ENCFF002CPH POLR2A 9:71394602..71394992
ENCFF002CQA POLR2A 9:71394616..71394908
ENCFF002CQA POLR2A 9:71394705..71395275
ENCFF002CQC POLR2A 9:71394674..71395144
ENCFF002CQE POLR2A 9:71394664..71395159
ENCFF002CQG POLR2A 9:71394895..71395126
ENCFF002CQI POLR2A 9:71394722..71395181
ENCFF002CQK POLR2A 9:71394646..71395226
ENCFF002CQM POLR2A 9:71394672..71395152
ENCFF002CQO POLR2A 9:71394629..71395178
ENCFF002CRK POLR2A 9:71394693..71395217
ENCFF002CRO POLR2A 9:71394588..71395008
ENCFF002CSY POLR2A 9:71394580..71395168
ENCFF002CUP POLR2A 9:71394806..71394903
ENCFF002CUQ POLR2A 9:71394653..71394936
ENCFF002CVF POLR2A 9:71394605..71395021
ENCFF002CVJ POLR2A 9:71394667..71394898
ENCFF002CXM POLR2A 9:71394564..71395054
ENCFF002CXN POLR2A 9:71394568..71395064
ENCFF002CXO POLR2A 9:71394580..71395004
ENCFF002CXP POLR2A 9:71394593..71395073
ENCFF002CXP POLR2A 9:71394792..71395272
ENCFF002CXR POLR2A 9:71394718..71395083
ENCFF002CZC POLR2A 9:71394606..71395109
ENCFF002CZD POLR2A 9:71394634..71395110
ENCFF002CZQ POLR2A 9:71394726..71395011
ENCFF002CZW POLR2A 9:71394523..71395290
ENCFF002CZY POLR2A 9:71394588..71395196
ENCFF002DAE POLR2A 9:71394714..71395024
ENCFF002DAH POLR2A 9:71394931..71395044
ENCFF002DAK POLR2A 9:71394571..71395071
ENCFF002DAS POLR2A 9:71394588..71395064
ENCFF002DAV POLR2A 9:71394633..71395177
ENCFF002DBB POLR2A 9:71394913..71395113
ENCFF002DBE POLR2A 9:71394601..71395097
ENCFF002DBO POLR2A 9:71394883..71395137
ENCFF002DBP POLR2A 9:71394951..71395111
ENCFF002DBQ POLR2A 9:71394658..71395028
ENCFF002DBT POLR2A 9:71394648..71395018
ENCFF002DBT POLR2A 9:71394847..71395217
4 EST(s) were mapped to retro_hsap_35 retrocopy
EST ID Start End Identity Match Mis-match Score
AW798921 71395666 71395814 100 148 0 148
BF926702 71395208 71395606 98 390 7 381
BM720476 71395636 71395769 100 133 0 133
HY293038 71395072 71395539 99.8 466 1 465


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr ≤ 1 1 < Expr ≤ 5 5 < Expr ≤ 10 Expr > 10
TSS #1 TSS_19368619 libraries 0 libraries 17 libraries 196 libraries 1597 libraries
TSS #2 TSS_1936871498 libraries 294 libraries 37 libraries 0 libraries 0 libraries

The graphical summary, for retro_hsap_35 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

retro_hsap_35 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_35 has 6 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Mus musculus retro_mmus_22
Rattus norvegicus retro_rnor_651
Oryctolagus cuniculus retro_ocun_205
Bos taurus retro_btau_103
Canis familiaris retro_cfam_181
Equus caballus retro_ecab_91

Parental genes homology:
Parental genes homology involve 3 parental genes, and 3 retrocopies.

Species Parental gene accession Retrocopies number
Homo sapiens ENSG00000156500 1 retrocopy
retro_hsap_35 ,
Nomascus leucogenys ENSNLEG000000020841 retrocopy
Oryctolagus cuniculus ENSOCUG000000297371 retrocopy

Expression level across human populations :

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Undefined variable $populLEGEND in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM

Fatal error: Uncaught Error: Call to undefined function mysql_query() in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php:3390 Stack trace: #0 /home/rosikiewicz/RetrogeneDB2/BETA/retrogene.php(1158): include() #1 {main} thrown in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3390