RetrogeneDB ID:

retro_hsap_69

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:17:51900394..51902416(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000141200
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:KIF2A
Ensembl ID:ENSG00000068796
Aliases:None
Description:kinesin heavy chain member 2A [Source:HGNC Symbol;Acc:6318]


Retrocopy-Parental alignment summary:






>retro_hsap_69
ATGGCCAGCCAGTTCTGCCTCCCTGAATCCCCATGTCTCTCGCCCCTGAAACCCTTGAAGCCACATTTCGGAGACATCCA
AGAGGGCATCTACGTGGCGATCCAGCGCAGTGACAAGCGGATCCACCTCGCTGTGGTCACGGAGATCAACAGAGAAAACT
ATTGGGTCACGGTAGAGTGGGTGGAGAAAGCAGTCAAAAAAGGCAAGAAGATTGACCTGGAGACCATACTCCTGCTGAAT
CCAGCTCTGGACTCTGCTGAACACCCCATGCCGCCCCCGCCCTTATCCCCCTTGGCTCTGGCGCCCTCTTCGGCCATCAG
GGACCAGCGTACCGCCACGAAATGGGTTGCGATGATCCCCCAGAAAAACCAAACAGCCTCAGGGGACAGCCTGGATGTGA
GGGTCCCCAGCAAACCTTGTCTGATGAAGCAGAAAAAGTCTCCCTGCCTCTGGGAAATCCAGAAACTGCAGGAGCAGCGG
GAAAAGCGCAGGCGGCTGCAGCAGGAGATCCGAGCTAGACGCGCCCTCGATGTCAATACCAGAAACCCCAACTACGAAAT
CATGCACATGATCGAAGAGTATCGCAGGCACCTGGACAGCAGCAAGATCTCAGTCCTGGAGCCCCCGCAAGAACATCGCA
TCTGCGTCTGCGTGAGGAAGCGGCCTCTCAACCAGCGAGAGACAACCTTAAAGGACCTGGATATCATCACCGTCCCCTCG
GACAATGTGGTTATGGTGCATGAGTCCAAGCAAAAGGTGGACCTCACTCGCTACCTGCAGAACCAGACCTTCTGCTTCGA
CCATGCCTTCGATGACAAAGCCTCCAACGAGTTGGTGTACCAGTTCACCGCCCAGCCACTGGTGGAGTCCATCTTCCGCA
AGGGCATGGCCACCTGCTTTGCCTATGGGCAGACGGGAAGTGGGAAGACGTACACCATGGGTGGAGACTTTTCAGGAACG
GCCCAAGATTGTTCTAAGGGCATTTATGCTCTGGTGGCACAGGATGTCTTTCTCCTGCTCAGAAACTCCACATATGAGAA
GCTGGACCTCAAAGTCTATGGGACATTTTTTGAGATTTATGGGGGCAAGGTGTATGATTTGTTGAACTGGAAGAAGAAGC
TGCAAGTCCTTGAGGATGGCAATCAGCAAATCCAAGTGGTCGGGCTGCAGGAGAAAGAGGTGTGTTGTGTGGAGGAAGTG
CTGAACCTGGTGGAAATAGGGAATAGCTGTCGGACTTCCAGGCAAACACCTGTCAACGCTCACTCATCCAGGAGCCATGC
AGTGTTCCAGATCATCCTGAAGTCAGGACGGATAATGCATGGCAAGTTTTCCCTCGTTGATTTAGCTGGGAATGAAAGAG
GAGCAGATACAACCAAGGCCAGCCGGAAAAGGCAGCTGGAAGGGGCAGAGATTAACAAGAGTCTTCTAGCCCTCAAAGAA
TGTATTCTGGCTTTGGGTCAGAACAAGCCTCACACCCCATTCAGAGCCAGCAAACTCACACTGGTGCTCCGGGACTCCTT
TATAGGCCAGAACTCCTCCACTTGCATGATTGCTACCATCTCTCCGGGGATGACCTCTTGTGAAAACACTCTCAACACTT
TAAGATATGCAAACAGAGTAAAAAAATTAAATGTAGATGTAAGGCCCTACCATCGTGGCCACTATCCGATTGGACATGAG
GCACCAAGGATGTTAAAAAGTCACATCGGAAATTCAGAAATGTCCCTTCAGAGGGATGAATTTATTAAAATACCTTATGT
ACAGAGTGAGGAGCAGAAAGAGATTGAAGAGGTTGAAACATTACCCACTCTGTTAGGGAAGGATACCACAATTTCAGGGA
AGGGATCTAGCCAATGGCTGGAAAACATCCAGGAGAGAGCTGGTGGAGTACACCATGATATTGATTTTTGCATTGCCCGG
TCTTTGTCCATTTTGGAGCAGAAAATTGATGCTCTGACCGAGATCCAAAAGAAACTGAAATTATTACTAGCTGACCTCCA
CGTGAAGAGCAAGGTAGAGTGA

ORF - retro_hsap_69 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 74.19 %
Parental protein coverage: 57.08 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalRRKSNCVKEVEKLQEKREKRRLQQQELREKRAQDVDATNPNYEIMCMIRDFRGSLDYRPLTTADPIDEHR
..KS.C..E..KLQE.REKRR..QQE.R..RA.DV...NPNYEIM.MI...R..LD........P..EHR
RetrocopyQKKSPCLWEIQKLQEQREKRRRLQQEIRARRALDVNTRNPNYEIMHMIEEYRRHLDSSKISVLEPPQEHR
ParentalICVCVRKRPLNKKETQMKDLDVITIPSKDVVMVHEPKQKVDLTRYLENQTFRFDYAFDDSAPNEMVYRFT
ICVCVRKRPLN..ET..KDLD.IT.PS..VVMVHE.KQKVDLTRYL.NQTF.FD.AFDD.A.NE.VY.FT
RetrocopyICVCVRKRPLNQRETTLKDLDIITVPSDNVVMVHESKQKVDLTRYLQNQTFCFDHAFDDKASNELVYQFT
ParentalARPLVETIFERGMATCFAYGQTGSGKTHTMGGDFSGKNQDCSKGIYALAARDVFLMLKKPNYKKLELQVY
A.PLVE.IF..GMATCFAYGQTGSGKT.TMGGDFSG..QDCSKGIYAL.A.DVFL.L....Y.KL.L.VY
RetrocopyAQPLVESIFRKGMATCFAYGQTGSGKTYTMGGDFSGTAQDCSKGIYALVAQDVFLLLRNSTYEKLDLKVY
ParentalATFFEIYSGKVFDLLNRKTKLRVLEDGKQQVQVVGLQEREVKCVEDVLKLIDIGNSCRTSGQTSANAHSS
.TFFEIY.GKV.DLLN.K.KL.VLEDG.QQ.QVVGLQE.EV.CVE.VL.L..IGNSCRTS.QT..NAHSS
RetrocopyGTFFEIYGGKVYDLLNWKKKLQVLEDGNQQIQVVGLQEKEVCCVEEVLNLVEIGNSCRTSRQTPVNAHSS
ParentalRSHAVFQIILRRKGKLHGKFSLIDLAGNERGADTSSADRQTRLEGAEINKSLLALKECIRALGRNKPHTP
RSHAVFQIIL......HGKFSL.DLAGNERGADT..A.R...LEGAEINKSLLALKECI.ALG.NKPHTP
RetrocopyRSHAVFQIILKSGRIMHGKFSLVDLAGNERGADTTKASRKRQLEGAEINKSLLALKECILALGQNKPHTP
ParentalFRASKLTQVLRDSFIGENSRTCMIATISPGMASCENTLNTLRYANRVKELTVD
FRASKLT.VLRDSFIG.NS.TCMIATISPGM.SCENTLNTLRYANRVK.L.VD
RetrocopyFRASKLTLVLRDSFIGQNSSTCMIATISPGMTSCENTLNTLRYANRVKKLNVD

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 0 .12 RPM 25 .94 RPM
bodymap2_adrenal 0 .08 RPM 28 .53 RPM
bodymap2_brain 0 .00 RPM 98 .96 RPM
bodymap2_breast 0 .00 RPM 22 .90 RPM
bodymap2_colon 0 .00 RPM 27 .69 RPM
bodymap2_heart 0 .00 RPM 8 .62 RPM
bodymap2_kidney 0 .00 RPM 18 .26 RPM
bodymap2_liver 0 .00 RPM 4 .39 RPM
bodymap2_lung 0 .00 RPM 25 .79 RPM
bodymap2_lymph_node 0 .00 RPM 34 .85 RPM
bodymap2_ovary 0 .00 RPM 46 .63 RPM
bodymap2_prostate 0 .00 RPM 23 .16 RPM
bodymap2_skeletal_muscle 0 .00 RPM 7 .75 RPM
bodymap2_testis 78 .98 RPM 95 .02 RPM
bodymap2_thyroid 0 .00 RPM 28 .21 RPM
bodymap2_white_blood_cells 0 .00 RPM 126 .40 RPM
RNA Polymerase II activity near the 5' end of retro_hsap_69 was not detected
105 EST(s) were mapped to retro_hsap_69 retrocopy
EST ID Start End Identity Match Mis-match Score
BF979470 51900290 51900993 97.4 672 3 651
BG717678 51900302 51900944 98.6 637 4 630
BG719749 51900306 51900942 99.6 631 3 626
BG721597 51900287 51901029 99.6 738 2 734
BG771992 51900306 51901110 99.2 788 6 775
BG772495 51900266 51901053 96.4 776 10 754
BI461290 51900306 51901088 97.9 772 5 758
BI462018 51900283 51900974 98.4 680 5 663
BI462901 51900290 51901142 97.9 806 13 786
BI463904 51900292 51900970 99.6 675 3 672
BI464561 51900306 51900907 98 593 4 580
BI561657 51900306 51901162 96 829 16 796
BI829106 51900300 51901019 99.6 719 0 718
BM560261 51900276 51901169 97.2 883 6 864
BP371564 51900289 51901010 99.9 581 1 579
BP371589 51900936 51901604 99.9 567 1 565
CD171892 51900328 51901130 98.6 799 3 792
CD244601 51900427 51901269 97.9 840 2 829
CD299965 51900313 51901159 98.4 844 2 836
CD634108 51900475 51901008 99.9 532 1 531
CD634109 51900299 51901008 99.2 708 1 705
CD634110 51900299 51901008 99.8 706 2 703
CD634111 51900299 51901008 99.9 708 1 707
CD634112 51900299 51900978 99 672 4 662
CD634113 51900288 51901008 99.4 718 1 714
CD634114 51900288 51901008 98.7 717 2 710
CD634115 51900299 51901008 99.5 708 1 706
CD634116 51900288 51901008 98.9 716 3 710
CD634117 51900299 51900922 99.9 622 1 621
CV030651 51900394 51901003 100 609 0 609
DB020022 51900481 51901036 99.9 554 1 553
DB020310 51900269 51900900 99.7 571 1 568
DB022664 51900287 51900843 99.3 555 1 553
DB022991 51900287 51900853 99.9 565 1 564
DB024150 51900287 51900835 100 548 0 548
DB024991 51900291 51900848 99.9 556 1 555
DB026207 51900283 51900839 100 556 0 556
DB027113 51900296 51900834 99.9 537 1 536
DB027216 51900288 51901057 99.9 600 1 598
DB027224 51900306 51900904 100 598 0 598
DB027590 51900307 51900884 100 577 0 577
DB028384 51900296 51900839 99.9 542 1 541
DB028704 51900289 51900870 99.9 580 1 579
DB029624 51900289 51900880 100 591 0 591
DB029947 51900277 51900880 100 603 0 603
DB030135 51900306 51900903 99.7 571 1 568
DB031001 51900306 51900873 99.9 566 1 565
DB031046 51900552 51901124 99.7 570 2 568
DB031435 51900275 51900884 99.7 607 2 605
DB031441 51900306 51900929 100 623 0 623
DB033974 51900296 51900866 99.7 568 2 566
DB034169 51900287 51900881 100 594 0 594
DB034667 51900306 51900886 99.9 579 1 578
DB035029 51900306 51900858 99.9 551 1 550
DB035419 51900301 51900851 99.9 549 1 548
DB035778 51900287 51900862 99.9 574 1 573
DB036627 51900287 51900863 100 576 0 576
DB038024 51900306 51900881 99.9 574 1 573
DB038823 51900306 51900881 100 574 0 574
DB040581 51900306 51900868 99.7 559 1 556
DB040676 51900306 51900868 99.9 561 1 560
DB041512 51900287 51900840 99.7 551 2 549
DB041680 51900287 51900835 99.9 547 1 546
DB042083 51900619 51901199 98.8 578 2 574
DB042261 51900306 51900897 99.7 589 2 587
DB042755 51900306 51900858 99.5 552 0 551
DB042765 51900287 51900843 99.7 554 2 552
DB043236 51900287 51900862 99.9 574 1 573
DB043273 51900287 51900863 100 576 0 576
DB043535 51900306 51900865 99.9 558 1 557
DB044392 51900289 51900845 99.9 555 1 554
DB044824 51900301 51900853 99.9 551 1 550
DB044886 51900287 51900850 99.5 560 3 557
DB045217 51900287 51900848 100 561 0 561
DB045293 51900927 51901498 99.9 570 1 569
DB045885 51900306 51900859 99.9 552 1 551
DB045896 51900306 51900864 100 558 0 558
DB045982 51900306 51900877 99.9 570 1 569
DB046738 51900287 51900852 99.9 564 1 563
DB047467 51900289 51900855 100 566 0 566
DB047630 51900306 51900883 99.9 576 1 575
DB047718 51900296 51900845 99.9 548 1 547
DB048033 51900306 51900856 100 550 0 550
DB048739 51900287 51900871 99.9 583 1 582
DB049910 51900283 51900847 99.9 563 1 562
DB050148 51900287 51900863 99.7 574 2 572
DB050845 51900300 51900858 99.9 557 1 556
DB051208 51900306 51900889 99.9 582 1 581
DB052193 51900306 51900866 99.9 559 1 558
DB053072 51900306 51900875 100 569 0 569
DB053423 51900287 51900841 100 554 0 554
DB056105 51900304 51900860 99.7 554 2 552
DB056441 51900296 51900817 99.9 520 1 519
DB057938 51900306 51900838 99.9 531 1 530
DB058724 51900289 51900832 100 543 0 543
DB060434 51900287 51900839 99.9 551 1 550
DB089298 51900306 51900868 99.9 561 1 560
DB093988 51900283 51900839 99.9 555 1 554
DB446880 51900323 51900761 99.6 436 1 433
DB456589 51900314 51900795 99.6 479 2 477
DB459465 51900306 51900793 99.2 486 1 484
DC396938 51900306 51901233 99.9 573 1 569
DC398892 51900306 51901088 99.9 550 1 548
HY012274 51900306 51900828 98.9 515 6 509
HY212815 51901082 51901565 99.6 481 2 479


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr โ‰ค 1 1 < Expr โ‰ค 5 5 < Expr โ‰ค 10 Expr > 10
TSS #1 TSS_607751811 libraries 13 libraries 2 libraries 0 libraries 3 libraries
TSS #2 TSS_607761824 libraries 3 libraries 2 libraries 0 libraries 0 libraries
TSS #3 TSS_607771825 libraries 1 library 2 libraries 1 library 0 libraries

The graphical summary, for retro_hsap_69 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

retro_hsap_69 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_69 has 2 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Pongo abelii retro_pabe_88
Equus caballus retro_ecab_32

Parental genes homology:
Parental genes homology involve 24 parental genes, and 30 retrocopies.

Species Parental gene accession Retrocopies number
Anas platyrhynchos ENSAPLG000000095191 retrocopy
Bos taurus ENSBTAG000000150221 retrocopy
Choloepus hoffmanni ENSCHOG000000078881 retrocopy
Cavia porcellus ENSCPOG000000093931 retrocopy
Dipodomys ordii ENSDORG000000063351 retrocopy
Equus caballus ENSECAG000000198101 retrocopy
Homo sapiens ENSG00000068796 1 retrocopy
retro_hsap_69 ,
Gorilla gorilla ENSGGOG000000047741 retrocopy
Macaca mulatta ENSMMUG000000003991 retrocopy
Monodelphis domestica ENSMODG000000196051 retrocopy
Mus musculus ENSMUSG000000216931 retrocopy
Nomascus leucogenys ENSNLEG000000028651 retrocopy
Oryctolagus cuniculus ENSOCUG000000104661 retrocopy
Otolemur garnettii ENSOGAG000000005275 retrocopies
Ochotona princeps ENSOPRG000000117681 retrocopy
Procavia capensis ENSPCAG000000050891 retrocopy
Rattus norvegicus ENSRNOG000000140002 retrocopies
Sorex araneus ENSSARG000000077681 retrocopy
Sarcophilus harrisii ENSSHAG000000019501 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000127101 retrocopy
Tupaia belangeri ENSTBEG000000093961 retrocopy
Tarsius syrichta ENSTSYG000000021151 retrocopy
Vicugna pacos ENSVPAG000000088641 retrocopy
Drosophila melanogaster FBgn00302682 retrocopies

Expression level across human populations :

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Undefined variable $populLEGEND in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM

Fatal error: Uncaught Error: Call to undefined function mysql_query() in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php:3390 Stack trace: #0 /home/rosikiewicz/RetrogeneDB2/BETA/retrogene.php(1158): include() #1 {main} thrown in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3390