RetrogeneDB ID: | retro_drer_25 | ||
Retrocopy location | Organism: | Zebrafish (Danio rerio) | |
| Coordinates: | 19:48956041..48956249(+) | ||
| Located in intron of: | None | ||
Retrocopy information | Ensembl ID: | None | |
| Aliases: | None | ||
| Status: | NOVEL | ||
Parental gene information | Parental gene summary: | ||
| Parental gene symbol: | CABZ01062563.1 | ||
| Ensembl ID: | ENSDARG00000086035 | ||
| Aliases: | None | ||
| Description: | None |
Retrocopy-Parental alignment summary:
>retro_drer_25
TCCATCCATCCATCTCCATATCTCTATCTTTCCATAAAATCATCCGCCCATCTGTCCTTGCATCCATCATTTATCCATCT
ATATATATATCCTTGCATCCTTCCATCAATCTAGCCTTGCATCCACCCATTTAAACCATCCTTGCATCCACCCATCCATC
CATCCTAGCACTTATGCATCCACCTTTGTATCAATCCATCCATCTATG
ORF - retro_drer_25 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
| Percent Identity: | 52.78 % |
| Parental protein coverage: | 68.63 % |
| Number of stop codons detected: | 1 |
| Number of frameshifts detected: | 1 |
Retrocopy - Parental Gene Alignment:
| Parental | SIHPSIHPSIHPSIHPSIHAILLPS-VCLLFHPSIHPSIHPSIHPSI-HPFIHPSIYPSIPHFVYCSIHP |
| SIHPS..P....SI..S.H..L.PS...L...P.I.PSI.P.IHP...HP.IHPSI.PS.......SIHP | |
| Retrocopy | SIHPS--PYLYLSIKSSAHLSLHPSFIHLYIYPCILPSI*PCIHPFK>HPCIHPSIHPSTYASTFVSIHP |
| Parental | SM |
| SM | |
| Retrocopy | SM |
Legend:
| * | Stop codon |
| > | Forward frameshift by one nucleotide |
| < | Reverse frameshift by one nucleotide |
Danio rerio was not studied using RNA-Seq expression data.
Danio rerio was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_drer_25 retrocopy.
Danio rerio was not studied using FANTOM5 data.
retro_drer_25 was not experimentally validated.
Retrocopy orthology:
Retrocopy retro_drer_25 has 0 orthologous retrocopies within teleost group .Parental genes homology:
Parental genes homology involve 3 parental genes, and 5 retrocopies.| Species | Parental gene accession | Retrocopies number | |
|---|---|---|---|
| Danio rerio | ENSDARG00000086035 | 3 retrocopies |
retro_drer_25 , retro_drer_34, retro_drer_37,
|
| Danio rerio | ENSDARG00000090390 | 1 retrocopy | |
| Ficedula albicollis | ENSFALG00000013753 | 1 retrocopy |