RetrogeneDB ID:

retro_hsap_58

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:X:56590306..56592181(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000188021
Aliases:UBQLN2, ALS15, CHAP1, DSK2, N4BP4, PLIC2
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:UBQLN1
Ensembl ID:ENSG00000135018
Aliases:UBQLN1, DA41, DSK2, PLIC-1, UBQN, XDRP1
Description:ubiquilin 1 [Source:HGNC Symbol;Acc:12508]


Retrocopy-Parental alignment summary:






>retro_hsap_58
ATGGCTGAGAATGGCGAGAGCAGCGGCCCCCCGCGCCCCTCCCGCGGCCCTGCTGCGGCCCAAGGCTCGGCTGCTGCCCC
GGCTGAGCCTAAAATCATCAAAGTCACGGTGAAGACTCCCAAAGAGAAAGAGGAGTTCGCGGTGCCCGAGAACAGCTCGG
TTCAGCAGTTTAAGGAAGCGATTTCGAAACGCTTCAAATCCCAAACCGATCAGCTAGTGCTGATTTTTGCCGGAAAAATC
TTAAAAGATCAAGATACCTTGATCCAGCATGGCATCCATGATGGGCTGACTGTTCACCTTGTCATCAAAAGCCAGAACCG
ACCTCAGGGCCAGTCCACGCAGCCTAGCAATGCCGCGGGAACTAACACTACCTCGGCGTCGACTCCCAGGAGTAACTCCA
CACCTATTTCCACAAATAGCAACCCGTTTGGGTTGGGGAGCCTGGGAGGACTTGCAGGCCTTAGCAGCCTGGGCTTGAGC
TCGACCAACTTCTCTGAGCTCCAGAGCCAGATGCAGCAGCAGCTTATGGCCAGCCCTGAGATGATGATCCAAATAATGGA
AAATCCCTTTGTTCAGAGCATGCTTTCGAATCCCGATCTGATGAGGCAGCTCATTATGGCTAATCCACAGATGCAGCAAT
TGATTCAGAGAAACCCAGAAATCAGTCACCTGCTCAACAACCCAGACATAATGAGGCAGACACTCGAAATTGCCAGGAAT
CCAGCCATGATGCAAGAGATGATGAGAAATCAAGACCTGGCTCTTAGCAATCTAGAAAGCATCCCAGGTGGCTATAATGC
TTTACGGCGCATGTACACTGACATTCAAGAGCCGATGCTGAATGCCGCACAAGAGCAGTTTGGGGGTAATCCATTTGCCT
CCGTGGGGAGTAGTTCCTCCTCTGGGGAAGGTACGCAGCCTTCCCGCACAGAAAATCGCGATCCACTACCCAATCCATGG
GCACCACCGCCAGCTACCCAGAGTTCTGCAACTACCAGCACGACCACAAGCACTGGTAGTGGGTCTGGCAATAGTTCCAG
CAATGCTACTGGGAACACCGTTGCTGCCGCTAATTATGTCGCCAGCATCTTTAGTACCCCAGGCATGCAGAGCCTGCTGC
AACAGATAACTGAAAACCCCCAGCTGATTCAGAATATGCTGTCGGCGCCCTACATGAGAAGCATGATGCAGTCGCTGAGC
CAGAATCCAGATTTGGCTGCACAGATGATGCTGAATAGCCCGCTGTTTACTGCAAATCCTCAGCTGCAGGAGCAGATGCG
GCCACAGCTCCCAGCCTTCCTGCAGCAGATGCAGAATCCAGACACACTATCAGCCATGTCAAACCCAAGAGCAATGCAGG
CTTTAATGCAGATCCAGCAGGGGCTACAGACATTAGCCACTGAAGCACCTGGCCTGATTCCGAGCTTCACTCCAGGTGTG
GGGGTGGGGGTGCTGGGAACCGCTATAGGCCCTGTAGGCCCAGTCACCCCCATAGGCCCCATAGGCCCTATAGTCCCTTT
TACCCCCATAGGCCCCATTGGGCCCATAGGACCCACTGGCCCTGCAGCCCCCCCTGGCTCCACCGGCTCTGGTGGCCCCA
CGGGGCCTACTGTGTCCAGCGCTGCACCTAGTGAAACCACGAGTCCTACATCAGAATCTGGACCCAACCAGCAGTTCATT
CAGCAAATGGTGCAGGCCCTGGCTGGAGCAAATGCTCCACAGCTGCCGAATCCAGAAGTCAGATTTCAGCAACAACTGGA
ACAGCTCAACGCAATGGGGTTCTTAAACCGTGAAGCAAACTTGCAGGCCCTAATAGCAACAGGAGGCGACATCAATGCAG
CCATTGAAAGGCTGCTGGGCTCCCAGCCATCGTAA

ORF - retro_hsap_58 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 79.28 %
Parental protein coverage: 85.23 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalMAESGESGGPPGSQDSAAGAEGAGAPAAAASAEPKIMKVTVKTPKEKEEFAVPENSSVQQFKEEISKRFK
MAE.GES.GPP......A.A.G.....AAA.AEPKI.KVTVKTPKEKEEFAVPENSSVQQFKE.ISKRFK
RetrocopyMAENGESSGPPRPSRGPAAAQGS----AAAPAEPKIIKVTVKTPKEKEEFAVPENSSVQQFKEAISKRFK
ParentalSHTDQLVLIFAGKILKDQDTLSQHGIHDGLTVHLVIKTQNRPQDHSAQQTNTAGSNVTTSSTPNSNSTSG
S.TDQLVLIFAGKILKDQDTL.QHGIHDGLTVHLVIK.QNRPQ..S.Q..N.AG.N.T..STP.SNST..
RetrocopySQTDQLVLIFAGKILKDQDTLIQHGIHDGLTVHLVIKSQNRPQGQSTQPSNAAGTNTTSASTPRSNSTPI
ParentalSATSNPFGLGGLGGLAGLSSLGLNTTNFSELQSQMQRQLLSNPEMMVQIMENPFVQSMLSNPDLMRQLIM
S..SNPFGLG.LGGLAGLSSLGL..TNFSELQSQMQ.QL...PEMM.QIMENPFVQSMLSNPDLMRQLIM
RetrocopySTNSNPFGLGSLGGLAGLSSLGLSSTNFSELQSQMQQQLMASPEMMIQIMENPFVQSMLSNPDLMRQLIM
ParentalANPQMQQLIQRNPEISHMLNNPDIMRQTLELARNPAMMQEMMRNQDRALSNLESIPGGYNALRRMYTDIQ
ANPQMQQLIQRNPEISH.LNNPDIMRQTLE.ARNPAMMQEMMRNQD.ALSNLESIPGGYNALRRMYTDIQ
RetrocopyANPQMQQLIQRNPEISHLLNNPDIMRQTLEIARNPAMMQEMMRNQDLALSNLESIPGGYNALRRMYTDIQ
ParentalEPMLSAAQEQFGGNPFASLVSNTSSGEGSQPSRTENRDPLPNPWAPQTSQSSSASSGTASTVGGTTGSTA
EPML.AAQEQFGGNPFAS..S..SSGEG.QPSRTENRDPLPNPWAP.....SSA...T....G...G...
RetrocopyEPMLNAAQEQFGGNPFASVGSSSSSGEGTQPSRTENRDPLPNPWAPPPATQSSATTSTTTSTGSGSGNSS
ParentalSGTSGQSTTAPNLVPGVGASMFNTPGMQSLLQQITENPQLMQNMLSAPYMRSMMQSLSQNPDLAAQMMLN
S...G....A.N.V....AS.F.TPGMQSLLQQITENPQL.QNMLSAPYMRSMMQSLSQNPDLAAQMMLN
RetrocopySNATGNTVAAANYV----ASIFSTPGMQSLLQQITENPQLIQNMLSAPYMRSMMQSLSQNPDLAAQMMLN
ParentalNPLFAGNPQLQEQMRQQLPTFLQQMQNPDTLSAMSNPRAMQALLQIQQGLQTLATEAPGLIPGFTPGLGA
.PLF..NPQLQEQMR.QLP.FLQQMQNPDTLSAMSNPRAMQAL.QIQQGLQTLATEAPGLIP.FTPG.G.
RetrocopySPLFTANPQLQEQMRPQLPAFLQQMQNPDTLSAMSNPRAMQALMQIQQGLQTLATEAPGLIPSFTPGVG-
ParentalLGSTGGSSGTNG
.G..G...G..G
RetrocopyVGVLGTAIGPVG

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 20 .49 RPM 138 .43 RPM
bodymap2_adrenal 11 .69 RPM 109 .25 RPM
bodymap2_brain 36 .05 RPM 240 .50 RPM
bodymap2_breast 11 .48 RPM 138 .97 RPM
bodymap2_colon 18 .12 RPM 156 .52 RPM
bodymap2_heart 23 .37 RPM 108 .55 RPM
bodymap2_kidney 19 .13 RPM 167 .24 RPM
bodymap2_liver 7 .52 RPM 136 .21 RPM
bodymap2_lung 26 .39 RPM 166 .93 RPM
bodymap2_lymph_node 32 .23 RPM 149 .24 RPM
bodymap2_ovary 24 .83 RPM 158 .96 RPM
bodymap2_prostate 29 .96 RPM 174 .95 RPM
bodymap2_skeletal_muscle 42 .25 RPM 219 .45 RPM
bodymap2_testis 12 .58 RPM 151 .20 RPM
bodymap2_thyroid 19 .30 RPM 166 .41 RPM
bodymap2_white_blood_cells 55 .09 RPM 208 .69 RPM
RNA Polymerase II activity may be related with retro_hsap_58 in 49 libraries
ENCODE library ID Target ChIP-Seq Peak coordinates
ENCFF002CGN POLR2A X:56589982..56590197
ENCFF002CIH POLR2A X:56589976..56590263
ENCFF002CIO POLR2A X:56589960..56590303
ENCFF002CJZ POLR2A X:56589910..56590307
ENCFF002CKX POLR2A X:56589940..56590275
ENCFF002CMI POLR2A X:56589896..56590305
ENCFF002COJ POLR2A X:56589877..56590313
ENCFF002CPG POLR2A X:56589834..56590324
ENCFF002CPH POLR2A X:56589870..56590260
ENCFF002CQC POLR2A X:56589960..56590243
ENCFF002CQE POLR2A X:56589943..56590239
ENCFF002CQG POLR2A X:56589980..56590200
ENCFF002CQI POLR2A X:56589966..56590208
ENCFF002CQK POLR2A X:56589952..56590276
ENCFF002CQM POLR2A X:56589944..56590248
ENCFF002CQO POLR2A X:56589982..56590290
ENCFF002CRO POLR2A X:56589870..56590290
ENCFF002CUP POLR2A X:56590091..56590178
ENCFF002CVF POLR2A X:56589901..56590317
ENCFF002CVJ POLR2A X:56589963..56590263
ENCFF002CXO POLR2A X:56589886..56590310
ENCFF002CXP POLR2A X:56590053..56590174
ENCFF002CXR POLR2A X:56589966..56590249
ENCFF002CZC POLR2A X:56589942..56590292
ENCFF002CZD POLR2A X:56589945..56590287
ENCFF002CZQ POLR2A X:56589858..56590308
ENCFF002CZY POLR2A X:56589954..56590279
ENCFF002DAE POLR2A X:56589955..56590265
ENCFF002DAH POLR2A X:56589946..56590230
ENCFF002DBB POLR2A X:56589993..56590193
ENCFF002DBE POLR2A X:56589981..56590199
ENCFF002DBO POLR2A X:56589970..56590229
ENCFF002DBP POLR2A X:56590005..56590206
ENCFF002DBQ POLR2A X:56589909..56590279
ENCFF002DBT POLR2A X:56589892..56590262
ENCFF002CJZ POLR2A X:56590683..56590928
ENCFF002CZD POLR2A X:56590766..56591276
ENCFF002CFW POLR2A X:56589895..56590401
ENCFF002CFX POLR2A X:56589905..56590427
ENCFF002CHO POLR2A X:56589862..56590506
ENCFF002CJE POLR2A X:56589893..56590370
ENCFF002CQA POLR2A X:56589836..56590406
ENCFF002CSY POLR2A X:56589862..56590524
ENCFF002CUQ POLR2A X:56589874..56590378
ENCFF002CXM POLR2A X:56589862..56590352
ENCFF002CXN POLR2A X:56589874..56590370
ENCFF002CZW POLR2A X:56589854..56590604
ENCFF002DAK POLR2A X:56589860..56590360
ENCFF002DAS POLR2A X:56589871..56590347
ENCFF002DAV POLR2A X:56589852..56590396
ENCFF002DAY POLR2A X:56589781..56590417
38 EST(s) were mapped to retro_hsap_58 retrocopy
EST ID Start End Identity Match Mis-match Score
AA211771 56591408 56591772 97.5 359 1 352
AA235610 56590733 56590848 100 115 0 115
AA721472 56590332 56590577 97.2 240 3 233
AI677838 56590325 56590811 99.2 482 4 478
AI738604 56590326 56590827 100 501 0 501
AI970587 56590297 56590845 99.7 545 2 543
AI140828 56590297 56590749 100 452 0 452
AW009308 56590325 56590886 98.4 549 8 539
AW087180 56590323 56590762 98.7 436 3 432
BE002124 56591157 56591491 99.7 328 1 322
BE170732 56591184 56591613 99.8 428 0 426
BE613953 56590658 56591420 98.7 754 5 744
BF833002 56590610 56590997 99.8 384 1 381
BM452656 56590402 56591322 98.2 912 1 899
BM455419 56591556 56591752 99.5 195 1 194
BM546710 56590723 56591389 97.1 639 9 622
BM922811 56591061 56591620 96.6 521 8 505
BQ224786 56591008 56591587 96.9 566 13 551
BQ307890 56591166 56591705 99.5 535 2 530
BQ320425 56590857 56591164 98.6 278 2 270
BU159505 56590702 56591511 98.4 797 2 788
BU178931 56591469 56591758 99.7 287 0 285
BY795607 56590471 56591073 99.9 601 1 600
CA390135 56591054 56591505 100 451 0 451
CD359581 56591591 56591797 97.1 200 5 193
CN304944 56590423 56590682 100 259 0 259
CR983559 56590597 56591321 99.4 724 0 722
D81089 56591391 56591593 98 199 1 197
DB485896 56590517 56590962 99.8 443 1 441
DB489253 56590517 56590978 99.6 459 2 457
DB491959 56590517 56590918 99.8 400 1 399
DN998061 56590218 56590942 100 724 0 724
HY061829 56590288 56590798 99.1 510 0 508
HY149590 56591190 56591613 99.8 422 1 421
N56258 56591939 56592057 98.3 115 2 112
R49915 56591374 56591689 97.8 315 0 312
T06622 56590363 56590690 98.5 324 2 321
Z39763 56590307 56590593 99.7 283 0 281


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr โ‰ค 1 1 < Expr โ‰ค 5 5 < Expr โ‰ค 10 Expr > 10
TSS #1 TSS_20054825 libraries 0 libraries 7 libraries 46 libraries 1751 libraries
TSS #2 TSS_200549246 libraries 315 libraries 1126 libraries 123 libraries 19 libraries
TSS #3 TSS_2005501107 libraries 665 libraries 52 libraries 5 libraries 0 libraries

The graphical summary, for retro_hsap_58 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

retro_hsap_58 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_58 has 2 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Pan troglodytes retro_ptro_93
Pongo abelii retro_pabe_87

Parental genes homology:
Parental genes homology involve 21 parental genes, and 24 retrocopies.

Species Parental gene accession Retrocopies number
Bos taurus ENSBTAG000000148272 retrocopies
Canis familiaris ENSCAFG000000014351 retrocopy
Callithrix jacchus ENSCJAG000000036092 retrocopies
Cavia porcellus ENSCPOG000000048491 retrocopy
Dasypus novemcinctus ENSDNOG000000126871 retrocopy
Dipodomys ordii ENSDORG000000152661 retrocopy
Equus caballus ENSECAG000000191101 retrocopy
Echinops telfairi ENSETEG000000028221 retrocopy
Felis catus ENSFCAG000000150491 retrocopy
Homo sapiens ENSG00000135018 1 retrocopy
retro_hsap_58 ,
Homo sapiens ENSG000001608031 retrocopy
Myotis lucifugus ENSMLUG000000020362 retrocopies
Mustela putorius furoENSMPUG000000020281 retrocopy
Mus musculus ENSMUSG000000053121 retrocopy
Nomascus leucogenys ENSNLEG000000033061 retrocopy
Otolemur garnettii ENSOGAG000000129471 retrocopy
Pongo abelii ENSPPYG000000193231 retrocopy
Pan troglodytes ENSPTRG000000210551 retrocopy
Rattus norvegicus ENSRNOG000000192821 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000134621 retrocopy
Tursiops truncatus ENSTTRG000000046961 retrocopy

Expression level across human populations :

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Undefined variable $populLEGEND in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM

Fatal error: Uncaught Error: Call to undefined function mysql_query() in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php:3390 Stack trace: #0 /home/rosikiewicz/RetrogeneDB2/BETA/retrogene.php(1158): include() #1 {main} thrown in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3390