mature miRNA: TTGACAGAAGAGAGGGAGCAT species: Cichorium endivia database: miRNEST The numbers on the right side of the alignments show a score calculated for them. When calculating the score, a mismatch is given a score of 1, bulge: 2, and wobble: 0.5. |
Predicted miRNA targets | |||||||||
gi|125339107|gb|EL353701.1|EL353701 CCEM10343.b1_N18.ab1 CCE(LMS) endive Cichorium endivia cDNA clone CCEM10343, mRNA sequence TTGACAGAAGAGAGGGAGCAT |