mature miRNA: CGATTCCGTAGTCCATGAGCG species: Hordeum vulgare database: miRNEST The numbers on the right side of the alignments show a score calculated for them. When calculating the score, a mismatch is given a score of 1, bulge: 2, and wobble: 0.5. |
Predicted miRNA targets | |||||||||
gi|217053092|gb|GH219415.1|GH219415 HVSMEh0084N15f2 Hordeum vulgare 5-45 DAP spike cDNA library HVSMEh (HVcDNA0009)2 Hordeum vul CGATTCCGTAGTCCATGAGCG |