| Basic information from miRBase |
| hairpin accession number: MI0016689 |
| Located between position 124360274 and 124360370 on chromosome 8 strand + |
| Overlapping with antisense strand of ATAD2-004 (intron 15). |
| (Ensemble: OTTHUMT00000381769) |
| mature miRNAs for MI0016689: |
| hsa-miR-548aa (MIMAT0018447): AAAAACCACAATTACTTTTGCACCA |
| You can find this miRNA in ENTREZGENE: MIR548AA1 (accession: 100500863) |
| References |
| [1]Witten D, Tibshirani R, Gu SG, Fire A, Lui WO, BMC Biol. 8:58(2010)., "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" |