| Basic information from miRBase |
| hairpin accession number: MI0011329 |
| Located between position 30005862 and 30005934 on chromosome 15 strand + |
| Overlapping with sense strand of GRIK4 (intron 4). |
| (Ensemble: ENSBTAT00000022788) |
| mature miRNAs for MI0011329: |
| bta-miR-2312 (MIMAT0011828): AAAACCTGAACGAACTTTTC |
| You can find this miRNA in ENTREZGENE: MIR2312 (accession: 100313280) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |