| Basic information from miRBase |
| hairpin accession number: MI0008771 |
| Located between position 101873557 and 101873623 on chromosome 1 strand + |
| Overlapping with sense strand of XM_513592.2 (intron 8). |
| (Ensemble: ENSPTRT00000001882) |
| mature miRNAs for MI0008771: |
| ptr-miR-553 (MIMAT0008234): AAAACGGTGAGATTTTGTTTT |
| You can find this miRNA in ENTREZGENE: MIR553 (accession: 100316223) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |