| Basic information from miRBase |
| hairpin accession number: MI0016407 |
| Located between position 20677448 and 20677546 on chromosome 4 strand + |
| Overlapping with sense strand of myf5-001 (intron 1). |
| (Ensemble: OTTDART00000009544) |
| mature miRNAs for MI0016407: |
| dre-miR-3906 (MIMAT0018177): AAAAGCATTTTGAATGCAGATTT |
| You can find this miRNA in ENTREZGENE: mir3906 (accession: 100526372) |
| References |
| [1]Hsu RJ, Lin CY, Hoi HS, Zheng SK, Lin CC, Tsai HJ, Nucleic Acids Res. 38:4384-4393(2010)., "Novel intronic microRNA represses zebrafish myf5 promoter activity through silencing dickkopf-3 gene" |