| Basic information from miRBase |
| hairpin accession number: MI0008608 |
| Located between position 120936437 and 120936514 on chromosome 1 strand - |
| mature miRNAs for MI0008608: |
| ptr-miR-320b (MIMAT0008094): AAAAGCTGGGTTGAGAGGGCAA |
| You can find this miRNA in ENTREZGENE: MIR320B-1 (accession: 100316458) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |