Basic information from miRBase |
hairpin accession number: MI0008609 |
Located between position 204871621 and 204871757 on chromosome 1 strand - |
Overlapping with sense strand of (intron 16). |
(Ensemble: ENSPTRT00000003680) |
mature miRNAs for MI0008609: |
ptr-miR-320b (MIMAT0008094): AAAAGCTGGGTTGAGAGGGCAA |
You can find this miRNA in ENTREZGENE: MIR320B-2 (accession: 100316136) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |