miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008609
Located between position 204871621 and 204871757 on chromosome 1 strand -
Overlapping with sense strand of (intron 16).
(Ensemble: ENSPTRT00000003680)
mature miRNAs for MI0008609:
         ptr-miR-320b (MIMAT0008094): AAAAGCTGGGTTGAGAGGGCAA
You can find this miRNA in ENTREZGENE: MIR320B-2 (accession: 100316136)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"