| Basic information from miRBase |
| hairpin accession number: MI0008607 |
| Located between position 18580789 and 18580869 on chromosome 8 strand - |
| mature miRNAs for MI0008607: |
| ptr-miR-320a (MIMAT0008093): AAAAGCTGGGTTGAGAGGGCGA |
| You can find this miRNA in ENTREZGENE: MIR320A (accession: 100316457) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |