| Basic information from miRBase |
| hairpin accession number: MI0008611 |
| Located between position 20139747 and 20139795 on chromosome 18 strand + |
| Overlapping with antisense strand of XM_523889.2 (intron 7). |
| (Ensemble: ENSPTRT00000018230) |
| mature miRNAs for MI0008611: |
| ptr-miR-320c (MIMAT0008095): AAAAGCTGGGTTGAGAGGGT |
| You can find this miRNA in ENTREZGENE: MIR320C-2 (accession: 100316541) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |