Basic information from miRBase |
hairpin accession number: MI0006412 |
Located between position 11400297 and 11400384 on chromosome 16 strand - |
mature miRNAs for MI0006412: |
hsa-miR-548h (MIMAT0005928): AAAAGTAATCGCGGTTTTTGTC |
You can find this miRNA in HGNC: MIR548H2 (accession: 35343) |
References | ||||||||||||||
[1]Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA, Genome Res. 18:610-621(2008)., "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" ![]() |
PROMOTER INFORMATION | ||||||||||||||
1058 | chr16, 11307798-11312885, - | promoter sequence | UCSC | ![]() | ![]() |