Basic information from miRBase |
hairpin accession number: MI0006414 |
Located between position 26906370 and 26906480 on chromosome 8 strand - |
mature miRNAs for MI0006414: |
hsa-miR-548h (MIMAT0005928): AAAAGTAATCGCGGTTTTTGTC |
You can find this miRNA in HGNC: MIR548H4 (accession: 35345) |
References | ||||||||||||||
[1]Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA, Genome Res. 18:610-621(2008)., "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" |
PROMOTER INFORMATION | ||||||||||||||
743 | chr8, 26962287-26967397, - | promoter sequence | UCSC |