| Basic information from miRBase |
| hairpin accession number: MI0008752 |
| Located between position 63543951 and 63544051 on chromosome 14 strand - |
| Overlapping with antisense strand of XM_001169949.1 (intron 62). |
| (Ensemble: ENSPTRT00000045362) |
| mature miRNAs for MI0008752: |
| ptr-miR-548h (MIMAT0008222): AAAAGTAATCGCGGTTTTTGTC |
| You can find this miRNA in ENTREZGENE: MIR548H (accession: 100316212) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |