| PROMOTER INFORMATION | ||||||||||||||
| 612 | chr3, 126991937-126997085, - | promoter sequence | UCSC |  | | |||||||||
| more data |
| Polymorphism data from Patrocles |
| Basic information from miRBase |
| hairpin accession number: MI0006421 |
| Located between position 125509247 and 125509395 on chromosome 3 strand - |
| mature miRNAs for MI0006421: |
| hsa-miR-548i (MIMAT0005935): AAAAGTAATTGCGGATTTTGCC |
| You can find this miRNA in HGNC: MIR548I1 (accession: 35352) |
| References | ||||||||||||||
| [1]Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA, Genome Res. 18:610-621(2008)., "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 612 | chr3, 126991937-126997085, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Polymorphism data from Patrocles |