| Basic information from miRBase |
| hairpin accession number: MI0008753 |
| Located between position 130179670 and 130179817 on chromosome 3 strand - |
| mature miRNAs for MI0008753: |
| ptr-miR-548i (MIMAT0008223): AAAAGTAATTGCGGATTTTGCC |
| You can find this miRNA in ENTREZGENE: MIR548I-1 (accession: 100316213) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |