miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008754
Located between position 15502551 and 15502698 on chromosome 3 strand -
mature miRNAs for MI0008754:
         ptr-miR-548i (MIMAT0008223): AAAAGTAATTGCGGATTTTGCC
You can find this miRNA in ENTREZGENE: MIR548I-2 (accession: 100316344)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"