Basic information from miRBase |
hairpin accession number: MI0008755 |
Located between position 6391111 and 6391258 on chromosome 7_random strand + |
mature miRNAs for MI0008755: |
ptr-miR-548i (MIMAT0008223): AAAAGTAATTGCGGATTTTGCC |
You can find this miRNA in ENTREZGENE: MIR548I-3 (accession: 100316214) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |