| Basic information from miRBase |
| hairpin accession number: MI0008756 |
| Located between position 7161530 and 7161677 on chromosome 8 strand - |
| mature miRNAs for MI0008756: |
| ptr-miR-548i (MIMAT0008223): AAAAGTAATTGCGGATTTTGCC |
| You can find this miRNA in ENTREZGENE: MIR548I-4 (accession: 100316485) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |